5.1. Patients
Renal tissue was obtained from patients diagnosed with GN based on biopsy-proven. The study was conducted in accordance with the Second Helsinki Declaration and approved by the Shenzhen Hospital of Southern Medical University Ethic Committee. All participants provided written informed consent.
5.2. Cell culture and treatment
Conditionally immortalized human podocyte cells (HPCs) were cultured as described previously [29]. The cells were grown at 33°C in RPMI-1640 medium (GIBCO, Invitrogen Corporation, NY, USA) supplemented with insulin-transferrin-selenium (GIBCO, Invitrogen Corporation, NY, USA), 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA) and Pen/Strep (Sigma, St. Louis, MO, USA). When the cells were 40–60% confluent, the temperature was increased to 37°C. The culture medium was changed three times per week. Typically, full differentiation occurred in 14 d. After differentiation was confirmed by the presence of synaptopodin, a marker of podocyte differentiation, the cells were synchronized into quiescence by growing the cells in serum-free DMEM medium for 24 h for the determination of NTCP expression. The differentiated podocytes were infected with HBV at 103 genome equivalents(GEq) per cell by culturing with the supernatant of HepG2.2.15 cells in vitro for 16 h. After discarding the free supernatant, culturing was continued until 9d after infection. The expressions of HBV DNA, HBV cccDNA, HBsAg, HBeAg, and HBcAg were detected at 1, 3, 5,7and 9d after infection.
HepG2.2.15 cells were grown in DMEM medium (GIBCO, Invitrogen Corporation, NY, USA) containing penicillin (100 U/mL), streptomycin (100 µg/mL), (Sigma, St. Louis, MO, USA), 1% mycoplasma expectorant (Beyotime Biotechnology, Shanghai, China), and 10% FBS (Hyclone, Logan, UT, USA). The culture medium was changed every other day. The expressions of HBV DNA and HBsAg were detected in the cell supernatant.
5.3. Immunohistochemistry
Four-micrometer sections of renal tissues were incubated in xylene, rehydrated in a graded ethanol series to water, and treated overnight with 0.1 mol/L citrate buffer antigen retrieval solution (pH 6.0; Beyotime) at 85°C to retrieve antigen exposure. Endogenous peroxidase was blocked with 3% H2O2 for 10 min. Nonspecific binding was blocked by incubation in 1% bovine serum albumin (BSA) in 0.01 mol/L Tris-HCl buffer (pH 8.6) with 0.01% Triton X-100 (BSA-T) at room temperature for 1 h. Rabbit polyclonal to NTCP (1:100, GTX 17693, Gene Tex, USA) overnight at 4°C. Excess, unbound primary antibody was removed by washing with Tris-HCl buffer. Specific immunoreaction was detected using secondary horseradish peroxidase-conjugated goat antirabbit antibody (Beyotime) as recommended by the manufacturer. After washing in Tris-HCl buffer, 3–3"-diaminbenzidine tetrahydrochloride (Beyotime) was used for visualization. The sections were counterstained with hematoxylin, dehydrated and dried using gradient alcohol, transparent in xylene, sealed with neutral gum, and photographed using a phase-contrast microscope at 400× magnification.
5.4. Immunofluorescence
For immunofluorescence labeling, 4-µm sections of renal tissue were washed once with PBS, permeabilized with 0.5% Triton X-100 in PBS, and incubated with 5% BSA for 30 min before further incubation with primary antibodies: synaptopodin rabbit polyclonal antibody (1:250, ab224491, Abcam, Cambridge) and NTCP rabbit polyclonal antibody (2 µg/mL, GTX 17693, Gene Tex, USA) overnight at 4°C. After washing three times with PBS for 5 min, the secondary antibody [goat anti-rabbit IgG H&L antibody (Alexa Fluor® 594; 1:1000, ab150080, Abcam, Cambridge) was applied for 1 h at room temperature away from light. After washed, the slides were mounted using antifade mounting medium (Beyotime Institute of Biotechnology, Shanghai, China).
All images were captured using a confocal microscope (Zeiss LSM, Zeiss, Germany) and analyzed by two investigators blind to the sample identity.
5.5. Transfection of shRNA-NTCP and WT-NTCP
The shRNA sequences targeting NTCP(NTCP-small hairpin RNA[shRNA]1: 5-TGCACCATGGAGTTCAGCA;NTCP-shRNA2:5-ATGGAGTTCAGCAAGATC A), shRNA control(shRNA control: 5-CTCGCTTGGGCGAG AGTAA) and over-expression plasmid WT-NTCP(F:GTTTGGATCCATGGAGG CCCACAACGCG TCTGCCC, R:CGCCACTAGTCTAG GCTGTGCAAGGGGAGCAGTCCT C)were synthesized by Ribo Bio Co. (Guangzhou, China). Transfection was carried out with the shRNAs shRNA-NC and WT-NTCP using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Waltham, MA) transfection reagent protocols. After 48 h of incubation with NTCP shRNA, shRNA-NC and WT-NTCP, the cells were treated according to the conditions of the different groups.
5.6. Real-time quantitative PCR for HBV DNA and HBV cccDNA
HBV DNA was extracted from human podocytes cultured in vitro using a QIAamp DNA Mini Kit (Da An Gene Co., Ltd., Zhong shan, Guangzhou, China). HBV DNA was detected and quantified using PCR using two sets of primers. The primer sequences were 5’-ATCCTGCTGCTATGCCTCATC TT-3’ (forward,F) and 5’-ACAGTGGGGGAAAGCCCTACGAA-3’ (reverse, R). The PCR cycling program consisted of an initial 2-min denaturing step at 93°C followed by 10 amplification cycles at 93°C for 45 s and 55°C for 60 s and 30 amplification cycles at 93°C for 30 s, 55°C for 45 s, and 40°C for 10 s. An HBV DNA load greater than or equal to 1 × 103 copies/mL was defined as positive.
The cells were collected and centrifuged at 800 rpm for 5 min. The precipitate was then collected, and 1 mL of lysate without proteinase K was added to every 1×106 cells. After incubation at 37°C for 60 min, 0.25 mL of 2.5 M KCl was added to the lysate product followed by shaking, mixing, and centrifugation at 12000 rpm for 5 min. After this step, all cccDNA and a small amount of rcDNA were located in the supernatant. HBV cccDNA was quantified by real-time PCR using an ABI 7500 Sequence Detection System. The primer sequences were 5’-TGCACTTCGCTTCACCT-3’ (forward, F) and 5’-AGGGGCATTTGGTGGTC-3’ (reverse, R) (Glebe et al., 2003; Yan et al, 2012). PCR was carried out in volume of 20 µL using Master Mix (ABI, USA). The PCR cycling program consisted of an initial denaturing step at 95°C for 10 min followed by one amplification cycle at 95°C for 10 s and 40 amplification cycles at 95°C for 5 s and 60°C for 31 s.
5.7. Detection of HBeAg and hepatitis B surface antigen (HBsAg) by enzyme-linked immunosorbent assay (ELISA)
HBeAg and HBsAg were detected in 50-µL volumes of supernatant using commercial ELISA kits (Kehua, Shanghai, China) following the manufacturer’s instructions. The ELISA results are presented as the S/CO ratio (S = sample ratio and CO = cutoff ratio).
5.8. Immunofluorescence detection of HBcAg
The podocytes in each group were inoculated in six-well plates. When the cells proliferated to 70%, 500 µL of 4% paraformaldehyde was added to fix the cells for 15 min. After washing three times with PBS and permeabilizing with 0.5% TritonX-100, primary antibody against HBcAg (ab8639 Abcam, Cambridge 1:100) was added and incubated overnight at 4°C. Subsequently, the cells were incubated with secondary antibody (goat anti-mouse IgG H&L; Alexa Fluor® 488; ab150113 Abcam, Cambridge 1:1000), washed three times with PBS, sealed with DAPI, and observed under a laser confocal microscope (Zeiss LSM, Zeiss, Germany). The field of view for imaging was randomly selected.
5.9. Western blotting
Western blotting was performed as described previously [30]. The primary and secondary antibodies were as follows: NTCP rabbit polyclonal antibody (2 µg/mL; GTX 17693, Gene Tex, USA), anti-GAPDH antibody (ab8245, Abcam, Cambridge 1:1000), and goat anti-rabbit IgG H&L(HRP) (ab6721, Abcam, Cambridge 1:10000).
5.10. Statistical analysis
All experimental procedures were repeated at least three times, and all reported values are mean ± standard deviation. Statistical analysis was performed using the SPSS 21.0 statistical package (IBM Co., Armonk, NY, USA). Multiple comparisons among groups were made using one-way analysis of variance with least significant difference test or Tukey’s test. Two-tailed p-values less than 0.05 were considered significant.