Mouse lines and ethical statement
Animal care and experimentation were carried out in strict adherence to the European Union Directive 2010/63 and ARRIVE guidelines 32 and authorized by the National Ethic Committee (Paris) (APAFIS #6341-2016080510211993). Mice were housed in group, in cages with free access to food and water, except during experiments, in temperature-controlled rooms, on 12:12-h light/dark cycle, lights on at 7:00 h. All animal experiments were performed during the light cycle.
Wfs1 ΔExon8 founder mice were provided by Dr Sulev Koks (University of Tartu, Estonia), generated as described in 29.
The Wfs1E864K mutant mouse line was established at the Institut Clinique de la Souris (http://www.ics-mci.fr/en/). In brief, C57BL/6N mouse embryonic stem (ES) cells were electroporated with a targeting vector carrying the G > A transversion at cDNA position 2590 (NM_011716.2) and a floxed neomycin resistance cassette. Following G418 selection, the clones were analyzed by long-range PCR (polymerase chain reaction) and southern blot using an internal neomycin probe and an external 5′ probe. The selected ES clone was karyotyped and micro-injected into BALB/c blastocysts. Resulting male chimeras were bred with wild-type C57BL/6N females, and germline transmission was achieved in the first litter. The Neo cassette, flanked with loxP sites, was removed by crossing the first generation with a CMV-Cre line. Mice were then intercrossed to generate wild-type, heterozygous and homozygous mutants as well as getting rid of the Cre allele. All functional assessments were performed with both males and females and no sex-related differences were measured.
,Genotyping and sequencing were performed with the following primers: AAATGTGCCAGTTGGGTGACTG (forward) and GTGGAATTACCACACGTGACTG (reverse) (WT amplicon, 265 base pairs (bp); mutant amplicon, 300 bp). Genotyping was performed using routine PCR and following protocol: 95°C for 3 min, 35 cycles (95°C for 30 s, 63°C for 30 s, and 72°C for 30 s), 72°C for 7 min. The different bands were separated on a 2% agarose gel.
Functional Hearing Assessments
All functional evaluations were performed under anesthesia, by an intraperitoneal injection of 2% xylazine (3mg/ml) and ketamine (40mg/kg), in both male and female mice. All functional evaluations were carried out in a Faraday-shielded, anechoic, sound-proof cage. Rectal temperature was measured with a thermistor probe and maintained at 38.5°C ± 1 using an underlying heated blanket.
Distortion products of otoacoustic amission (DPOAEs) and auditory brainstem responses (ABRs) were recorded at post-natal (P) day 21, P23, P25, P27, P29 and P31 of Wfs1WT, Wfs1E864K/+ and Wfs1E864K mice, 4-month-old, and 10-month-old Wfs1ΔExon8 mice and wild-type littermates. Endocochlear potential (EPs) were measured at P31, in Wfs1WT, Wfs1E864K/+ and Wfs1E864K mice.
DPOAEs
DPOAEs were recorded in the external auditory canal using an ER-10C S/N 2528 probe (Etymotic research Inc. Elk Grove Village, IL, USA). The two primary tones of frequency f1 and f2 with a constant f2/f1 ratio of 1.2 were generated, and the distortion product 2f1-f2 processed, by a Cubdis system HID 40133DP (Mimosa Acoustics Inc., Champaign, IL, USA). The probe was self-calibrated for the two stimulating tones before each recording. f1 and f2 were presented simultaneously, sweeping f2 from 20 to 2 KHz by quarter octave steps. For each frequency, the distortion product 2f1-f2 and the neighboring noise amplitude levels were measured and expressed as a function of f2.
ABRs
ABRs were recorded using three subcutaneous needle electrodes placed on the vertex (active), on the pinna of the tested ear (reference), and in the hind leg (ground). Strong correlations were observed between click-evoked ABR thresholds and pure-tone thresholds at 2 and 4 KHz 33. To obtain more frequency-specific estimates of hearing sensitivity in the high-frequency range, we chose to use tone-burst stimulation for ABR recording. Sound stimuli were generated by a NI PXI-4461 signal generator (National Instruments) and consisted of 10 ms tone-bursts with a 1 ms rise- and fall time, delivered at a rate of 10/s. Sound was produced by a JBL 075 loudspeaker (James B. Lansing Sound) positioned at 10 cm from the tested ear in a calibrated, free-field condition. Cochlear responses were amplified (20,000) via a Grass P511 differential amplifier, and averaged 1000 times (Dell Dimensions). Intensity-amplitude functions of the ABRs were obtained at each frequency tested (2, 4, 6.3, 8, 10, 12.5, 16, 20, 24, and 32 KHz) by varying the level of the tone bursts from 0 to 100 dB SPL, in 5 dB incremental steps. The ABR thresholds were defined as the minimum sound intensity necessary to elicit well-defined and reproducible wave II. Recordings and analysis were performed blindly.
Endocochlear potential (EP)
To measure the EP, the bone of the scala media basal turn was gently shaved off, resulting in a small fenestra. A glass microelectrode (tip diameter 0.1–0.5 µm), filled with 0.15M KCl and connected to a direct current amplifier (WPI, model 773 A; Sarasota, FL, USA), was placed visually at a position and angle allowing it to pass through the fenestra to record the EP with reference to an Ag/AgCl reference electrode in the neck musculature of the animal.
Balance Assessments
Rotarod
The balance and motor coordination of Wfs1E864K homozygous mice were assessed on a rotarod apparatus (Bioseb, Chaville, France). Ten to fifteen Wfs1WT and Wfs1E864K mice were first given a pretraining trial on day 1 (P24) in order to familiarize them with the rotating rod. They were trained to stay on the rod first at the lowest speed (4 rpm) and progressively at higher speeds (up to 10 rpm). They returned to the rotating rod following each fall (total of 4 trials on day 1). Testing of the mice occurred on day 2 (P25) and 3 (P26) at fixed speed (10 rpm), and latency to fall was measured for a maximum of 180s. Each mouse underwent 4 trials/day. For each day, the data were averaged for each mouse and then averaged for each group (Wfs1WT and Wfs1E864K homozygous mice).
Behavioral Experiments
The vestibular rating score was estimated as described previously 34,35. Wfs1WT and Wfs1E864K homozygous mice were each scored from 0 to 4, corresponding to normal behavior to maximal vestibular deficit. A score of 0 means that behavior is normal; a score of 1 means that the behavior is abnormal, but no specific vestibular deficit is effectively determined; a score of 2 corresponds to an identified but slight vestibular deficit; a score of 3 describes an identified and evident deficit; and a score of 4 means that vestibular deficit is maximal.
Six different tests were sequentially scored and totaled to rate the vestibular deficit as follows. 1) Head bobbing was tested when abnormal intermittent backward extension of the neck was observed. 2) Circling stereotyped movement was tested, ranging from none to compulsive circles around the animal’s hips. 3) The tail-hanging reflex, which normally induces a normal forelimb extension to reach the ground, results in the ventral bent of the body and grip of the tail when the vestibular deficit is maximal. 4) The contact-inhibition reflex normally leads the animal to hold on to a metal grid in a supine position to return when its back touches the ground. In the case of vestibular deficit with a lack in the body orientation referential, this reflex is abolished, and the animal continues gripping the grid in a supine position. 5) The air-righting reflex is necessary for animals to land on their feet when they fall from a supine position; vestibular dysfunction impairs this normal reversal, and a maximal deficit leads the animal to land on its back when dropped from a height of 40 cm onto a foam cushion. 6) Swimming was tested, ranging from a normal swimming behavior to drowning due to loss of all proprioceptive clues. Scores for all these tests were totaled and averaged to obtain the final vestibular deficit score.
Morphological Assessments
The ultrastructural characteristics of the cochlear sensory neural cells in 10-month-old Wfs1ΔExon8 mice and wild-type littermates and P23, P27 and P31 Wfs1WT and Wfs1E864K homozygous mice were analyzed using confocal microscopy (LSM880, Fast Airyscan, Zeiss) after immunohistochemistry, scanning electron microscopy (SEM, Hitachi S4000) and transmission electron microscopy (TEM, JEOL 1400 TEM).
The ultrastructural characteristics of the vestibular sensory neural cells in P23, P27, P31 and P66 Wfs1WT and Wfs1E864K homozygous mice were analyzed using SEM.
Cochlear sensory hair cells
Sensory hair-cell and stereocilia abnormalities of Wfs1ΔExon8, Wfs1WT and Wfs1E864K homozygous mice were evaluated using SEM. The cochleae were processed and evaluated using previously reported standard techniques 36. Acquisition of images of the inner (IHC) and outer (OHC) hair cells was performed in the apical (0.5 to 1 mm from apex tip, corresponding to the 6 to 8 KHz region), mid (1.9 to 3.3 mm from the apex tip, corresponding to the 12 to 24 KHz region), and basal (4.1 to 5.0 mm from the apex tip, corresponding to 32 to 50 KHz region) regions of the cochlea.
Spiral ganglion neurons and Stria vascularis
The cochleae from Wfs1WT and Wfs1E864K homozygous P31 mice were harvested, perfused through the round and oval windows, and fixed for approximately 30 min at room temperature (RT) with 10% formalin (VWR) diluted in phosphate buffered saline (PBS). The cochleae were decalcified in 0.2 M EDTA in PBS for 2 days before further processing. Cochleae were then placed in 10% sucrose in PBS, 2:1 10%:30% sucrose, 1:1 10%:30% sucrose, 1:2 10%:30% sucrose, for 30 min at room temperature each time, 30% sucrose in PBS overnight at 4°C and then Tissue-Tek OCT (Miles, Diagnostics Division, Elkhart, IN, USA) for 1 hour at room temperature. Cochleae were subsequently mounted in OCT, snap frozen on dry ice and cryosections were cut at 14 µm.
After 1 hour blocking with 10% Horse serum (HS) in PBS/0.1% Triton X-100 at room temperature, cochlear cryosections were immunostained, overnight at 4°C, with anti-Peripherin (1:200, Millipore, Cat#AB1530, RRID:AB_90725) and anti-Tubulin beta 3 (TUJ1) (1:400, BioLegend Cat# 801201, RRID:AB_2313773), to label the type II and types I and II spiral ganglion neurons, respectively. For stria vascularis analysis, cochlear cryosections were immunostained, overnight at 4°C, with anti-Claudin 11 (1:200, Thermo Fisher Scientific Cat# 36-4500, RRID:AB_2533259) anti-Kir4.1 (1:300, Alomone Labs Cat# APC-035, RRID:AB_2040120), anti-KCNQ1 (1:200, Santa Cruz Biotechnology Cat# sc-365186, RRID:AB_10707688) and anti-NKCC1 (1:200, Millipore Cat# AB3560P, RRID:AB_91514) to label the different cell layers of the stria vascularis. The sections were then washed in PBS/0.1% Triton X-100 three times, incubated for 1 hour at room temperature with secondary antibody solution (Alexa-488 conjugated goat anti-mouse IgG (1:500); Alexa-546 conjugated goat anti-rabbit IgG (1:500); Invitrogen) with 3% HS in 0.1% Triton X-100/PBS. Nuclei were counterstained using 4’,6-diamidino-2-phenylendole (DAPI; 1:5,000, Sigma-Aldrich). Cryosections were washed three times with PBS/0.1% Triton X-100, three times with PBS and mounted on glass slides with ProlongGold Antifade mounting medium (Invitrogen).
All images were acquired using a Zeiss LSM880 Fast-airy-scan scanning confocal microscope. NIH ImageJ software was used to determine the cross-sectional area of Rosenthal’s canal. SGN density was calculated by dividing the number of neurons by the cross-sectional area (n = four to five sections per cochlea, 3 to 4 cochleae per genotype).
Ultrastructural analysis: Transmission Electron Microscopy (TEM)
Morphological changes were investigated using TEM analyses. Wfs1WT and Wfs1E864K homozygous mice were perfused intracardially with a 4% formaldehyde solution in Sorensen's buffer (pH 7.4) for 30 min at room temperature. Both inner ears of each mouse were extracted and immersed in a solution of 2.5% glutaraldehyde in 0.1 M Sorensen buffer (pH 7.4) for 2 hour at 4°C, rinsed in Sorensen buffer and postfixed in a 2% osmium tetroxidefor 1 hour in the dark and at room temperature. After three rinses in Sorensen buffer, specimens were dehydrated in a graded series of ethanol solutions (30 to 100%) and were embedded in Epon. Ultrathin sections (70 nm; Leica-Reichert Ultracut E) were collected at different levels of each block. These sections were stained with uranyl acetate and lead citrate before examination in a JEOL 1400 TEM at 80 kV. To evaluate the vacuolization process in the different cell types of the cochleae, we photographed different sub-structures (SGN, SV, hair cells) for each sample with a 11 MegaPixel bottom-mounted TEM camera system (Quemesa, Olympus). The images were analysed via iTEM software (Olympus SIS).
Molecular Assessment
Constructs
Wild type (WT) human WFS1 cDNA (pCMV-Myc-WFS1) and human ATP1B1 (pCMV-HA-ATP1B1) were kindly gifted by Dr Barrett 17. The G > A transversion at cDNA position 2590 (NM_001145853.1) into WT WFS1 sequence was engineered by GeneScript and termed WFS1E864K.
Cell culture
Human embryonic kidney 293 cells (HEK293T) and Madin-Darby Canine Kidney cells (MDCK) were cultured in a high glucose and Glutamax supplemented Dulbecco’s Modified Eagle’s Medium (#31966-021, Sigma-Aldrich, Saint Louis, Missouri, USA) complemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich) and 20 mM penicillin/streptomycin (50U/ml, Sigma-Aldrich) and maintained at 37°C in 5% CO2.
Cell transfection
HEK293T cells (10 cm plates) and MDCK cells (6 well plates) were transfected at 80–90% confluency with 10µg/plate per construct (HEK) or 2µg/well per construct (MDCK), after mixing with polyethyleneimine (PEI-MAX; Polysciences, Inc.; Warrington, PA, USA) at a 1:3 ratio and 1:5 ratio of DNA:PEI in DMEM medium (Sigma-Aldrich), respectively. The mixture was then added to cells in DMEM medium that contained 2% FBS and 20 mM penicillin/streptomycin and grown for two days for HEK cells. MDCK cells were cultured for an additional 72 hours prior to immunostaining.
Co-immunoprecipitation (co-IP)
HA-tagged ATP1B1 and Myc-tagged WFS1 (WT or E864K) constructs were co-expressed in HEK293T cells, after transfection using PEI reagent (Polysciences). Forty-eight hours after transfection, cells were harvested and the pellets were homogenized with sonication in 600 µl of lysis buffer (50 mM Tris HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 3 mM EGTA, 1 mM DTT, 1% NP-40, 0.1% SDS, 0.1% DOC) containing a protease inhibitor mixture (Complete mini, Roche) and phosphatase inhibitor mixture (PhosSTOP, Sigma). 50 µl of protein G sepharose beads (protein G sepharose 4 Fast Flow, Cytiva) were prepared according to the manufacturer’s instructions and added to each lysate, incubated at 4°C overnight on a wheel. Immunoprecipitation was performed with 10 µg of an anti-HA (Biolegend, RRID: AB_2148451), at 4°C for 2 hours, on a wheel. The samples were then centrifuged at 500 rpm for 5 min and washed 3 times with 1 ml of lysis buffer. The pellets obtained after the last wash were resuspended in 50 µl of Laemmli sample buffer boiled at 95°C for 5 min. The supernatants and the cell lysates were loaded on an SDS-PAGE gel for western blotting. HA-tagged ATP1B1, Myc-tagged WT WFS1 and WFS1 E864K simple transfections were used as controls.
Biotinylation assay
Cell surface biotinylation study was performed as previously described 37. Briefly, HA-tagged ATP1B1 and Myc-tagged WFS1 (WT or E864K) constructs were co-expressed in HEK293T cells, after transfection using PEI reagent (Polysciences). Forty-eight hours after transfection, 10 cm HEK cell plates were washed in three times with ice-cold PBS containing 100 µM CaCl2 and 1 mM MgCl2. The surface proteins were biotinylated with EZ-Link Sulfo-NHS-SS-Biotin (# 21331, ThermoFisher) (1.5mg/ml in 10 mM triethanolamine pH 9.0, containing 2 mM CaCl2 and 150 mM NaCl) for 25 min, on ice, two times. Cells were then washed twice with ice-cold PBS containing 100 µM CaCl2, 1 mM MgCl2 and 100 mM glycine and quenched with the same buffer for 20 min on ice. After two additional washes in ice-cold PBS containing 100 µM CaCl2 and 1 mM MgCl2, the cells were lysed with cell lysis buffer (1% Triton X-100, 150 mM NaCl, 5 mM EDTA, 50 mM Tris-HCl, pH 7.5) for 1 hour on ice. Cell lysates were centrifuges at 14,000 g for 10 min at 4°C. Biotinylated proteins were precipitated with a 50% slurry of Streptavidin Agarose beads (# 20353, ThermoFisher) overnight, at 4°C. The beads were then washed twice with high-salt (0.1% Triton X-100, 500 mM NaCl, 5 mM EDTA, 50 mM Tris HCl, pH 7.5) then no-salt (50 mM Tris HCl, pH 7.5) washing buffers. Beads were incubated at 55°C for 30 min in 100 µl 2x Laemmli buffer. The supernatants and cell lysates were and loaded on a SDS-PAGE gel for western blotting. HA-tagged ATP1B1, Myc-tagged WT WFS1 and WFS1 E864K simple transfections were used as controls.
Western blot analysis
For co-IP and biotin assays, supernatants and cell lysates were separated on SDS-polyacrylamide gel and electroblotting onto a nitrocellulose membrane (Bio-Rad). Membranes were saturated with 5% non-fat milk dissolved in 0.1% PBS-Tween for 1 hour at room temperature and incubated overnight at 4°C with monoclonal mouse anti-HA (1:1,000 Biolegend), and anti-Myc (1:1,000 Biolegend). Membranes were then washed three times in 0.1% PBS-Tween and incubated with anti-mouse IgG horseradish peroxidase linked antibody (1:2,000 Abcam) for 1 hour at room temperature in 5% non-fat milk dissolved in 0.1% PBS-Tween. The immunoreactive proteins were visualized with enhanced chemiluminescence (ECL + Western Blotting Detection Reagents, Amersham Biosciences, UK) using the BioRad ChemiDoc2 Touch Imaging System.
Immunofluorescence
MDCK cells, 72 hours post transfection, were washed with PBS, fixed for 20 min in 4% paraformaldehyde and blocked with 10% HS/PBS/0.1% Triton X-100. The cells were incubated overnight at 4°C with primary antibody (1,1000 anti-Myc, Biolegend, San Diego, CA, USA, RRID: AB_2565336; 1,1000 anti-HA, Biolegend, RRID: AB_2148451) in 3% HS/PBS/0.1% Triton X-100. The cells were then washed in PBS/0.1% Triton X-100 and incubated with the Alexa-546 and Alexa-488 conjugated secondary antibodies (Life Technologies) in 3% HS/PBS/0.1% Triton X-100 for 1 hour at room temperature. Filamentous actin was detected with Alexa-647 phalloidin (ThermoFisher) in PBS/0.1% Triton X-100 for 1 hour. Following subsequent washes, the coverslips were placed using FluoroGel mounting medium (Electron Microscopy Sciences, Hatfield, PA, USA).
All images were acquired using a Zeiss LSM880 Fast Airyscan scanning confocal microscope that was equipped with 63x objective, and the analyses were performed using ImageJ software.
Statistical Analyses
Data are expressed as mean ± SEM. Statistical significance between groups was determined by unpaired Student’s t test or two-way ANOVA. The levels of statistical significance considered were: *p < 0.05, **p < 0.01, and ***p < 0.001. Statistical analyses were performed using the Prism v.7.0 software (GraphPad, San Diego, CA). Two-way ANOVA statistical values for Fig. 1 (Table S1), Fig. 2 (Table S2) and Fig. 3 (Table S3) are presented in the supplemental information.