Study design and area
This was a cross-sectional study conducted between January 2015 to December 2018 in five districts in four regions of Ghana. Ghana has a tropical climate with an average annual temperature of about 26 °C and the annual rainfall of 736.6 mm/29". Agriculture dominates the economy of Ghana and extensive farming practices in the country increase the livestock-wildlife-human interface.
Study population, sampling strategy, and data collection
A total of 1,498 animals aged ≥ 6 months, comprising 1,328 cattle, 104 sheep and 66 goats were included in the study. Sampling was done using a simple two-stage cluster sampling technique. The Regional Veterinary Officers of the Ministry of Food and Agriculture (MOFA), in the selected regions of Ghana, were contacted for information on animal populations in their respective regions prior to the study.
The list provided served as the sampling frame. Prior to the study, a survey was carried out and an inclusion criteria of animal population (cattle, sheep, and goats) ≥ 1,000 for districts to be eligible for selection for the study was upheld.
As a result, five (5) districts that fulfilled the criteria were randomly selected. Secondly, farms within these districts with herd size ≥ 100 animals were also randomly selected. All cattle, sheep, and goats within the selected farms were included in the study. If a district meets the first criteria, but the individual farms fail to meet the second criteria, farms which were very close to each other were pooled together. Sampling was done in the Bongo District in the Upper East; Savelugu and Wale wale in Northern; Ada West in Greater Accra, and North Tongu in Volta region.
Sample collection, processing and analysis.
Rectal swabs were collected from each animal using sterile swab sticks. The swabs were placed in pre-labeled cryotubes (SARSTADT, Nümbrecht, Germany) containing a viral RNA stabilization solution, RNAlater (Applied Biosystems, Foster City, CA, USA). Samples were then transported to the Kumasi Centre for Collaborative Research (KCCR) for storage at -70 °C prior to laboratory analysis.
Data and sample collection was done on the owners’ farms and in their presence, after which animals were released back to the owners.
Processing of rectal swabs for RNA extraction
Prior to RNA extraction and subsequent laboratory analysis, rectal samples were thawed at room temperature and vortexed. This was followed by centrifugation at 4000 g for 1–2 min before aliquoting 140 µl into new sterile tubes.
Testing of Faecal Swabs from Cattle, Sheep, and Goats using RT-PCR
Viral RNA Extraction
Viral RNA was extracted from all 1,498 samples using the spin protocol of the QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction. The RNA was eluted in 100 µl of buffer AVE (pre-warmed at 80oC). The eluted RNA was stored at -20oC until they were tested for BCoV using real-time polymerase chain reaction (RT-PCR).
PCR Product Generation
Detection of bovine CoV RNA was carried out using One-Step RT-PCR Kit (Qiagen, Hilden, Germany) and HCoV-OC43 primers. The following thermal protocol was used: reverse transcription at 50 °C for 30 min, Taq polymerase inactivation at 95 °C for 15 min, 45 cycles of 95 °C for 15 secs, and 60 °C for 30 secs. Amplification results were acquired at 60 °C. The total volume of the Qiagen one-step Master Mix was 25 µl per sample comprised of RNAse-free water (10.5 µl); Onestep 5 x buffer (5 µl); dNTP (1 µl); Forward primer (1 µl); Reverse primer (1 µl); OC43 probe (0.5 µl); enzyme mix (1 µl) and the 5 µl of the RNA template. The oligonucleotide sequences of the forward and reverse primers used for the amplification were CGATGAGGCTATTCCGACTAGGT and CCTTCCTGAGCCTTCAATATAGTAACC respectively, and the probe sequence used was TCCGCCTGGCACGGTACTCCCT as previously described [20].
Purification of DNA products for sequencing
All bovine coronavirus positive samples were confirmed by means of 1-step reverse transcription-heminested PCR, using primers CoV2A-F (CTTATGGGTTGGGATTATCC) and CoV2A-R (TAATAACAGACAACGCCATCATC) for the first round and the inner primers CoV2A-Rnest a (CCATCATCACTCAGAATCATCA) and CoV2A-Rnest b (CCATCATCAGAAAGAATCATCA) as previously described [21]. This generated a 404-base pair amplicon (Fig. 1) from the RNA-dependent RNA polymerase (RdRp) gene.
The PCR products were then prepared for Sanger sequencing by mixing 5 µL of the product with 2 µL of ExoSAP-IT™ (Thermo Fisher, MA, USA) and incubated at 37oC for 15 minutes. After this, the mixture was incubated at 80oC for 15 minutes and then stored at 4oC until use. A volume of 3 µL of each of these cleaned products was then pipetted into 2 tubes and 6 µL of RNAse-free water added to each tube. A volume of 1 µL of the forward primer was added to one tube and the same volume of nested reverse primers to the other tube to give a 10 µL total volume per tube. Sanger sequencing was done by Seqlab GmbH, GÖttingen Germany.
All obtained sequences from Seqlab were compared to sequences deposited on GenBank via the BLAST Algorithm and were aligned together with reference sequences from the Genbank. A cladogram was constructed using Bayesian inference which compared the partial BCoV RdRp sequence obtained from this study to those from different species and countries.
Statistical Analysis
Categorical data were presented as frequencies (percentages). Analysis of sequence data was done using the online BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to identify homologous strains. Construction of the phylogenetic tree was done by Bayesian inference using MrBayes [22] plugin in Geneious Prime 2019 (http://www.geneious.com). Graphical presentation was performed using GraphPad Prism 7 version 7.04 (GraphPad Software, Inc., La Jolla, California USA).