Study design/area and data collection
This was a cross-sectional study conducted from January 2015 to December 2018 in Ghana. Animals included in this study consist of 66 goats, 104 sheep and 1,328 cattle from five different districts in Ghana. A simple two-stage cluster sampling technique was used as previously described [19]. The districts included were North Tongu in Volta, Bongo District in the Upper East, Ada West in Greater Accra and Savelugu and Wale wale in Northern region. The number of farms and animal species from the four regions are shown in Table 1.
Sample collection, processing and analysis.
Rectal swabs were collected from each animal using sterile swab sticks. The swabs were placed in pre-labeled cryotubes (SARSTADT, Nümbrecht, Germany) containing a viral RNA stabilization solution, RNAlater (Applied Biosystems, Foster City, CA, USA). Samples were then transported to the Kumasi Centre for Collaborative Research (KCCR) for storage at -70°C prior to laboratory analysis.
Data and sample collection was done on the owners’ farms and in their presence, after which animals were released back to the owners. Less than 10% of all the animals sampled showed clinical signs such as diarrhea and respiratory distress except for high temperature which occurred in > 1000 of the animals [19].
Processing of rectal swabs for RNA extraction
Prior to RNA extraction and subsequent laboratory analysis, rectal samples were thawed at room temperature and vortexed. This was followed by centrifugation at 4000g for 1-2 min before aliquoting 140µl into new sterile tubes.
Testing of Faecal Swabs from Cattle, Sheep, and Goats using RT-PCR
Viral RNA Extraction
Viral RNA was extracted from all 1,498 samples using the spin protocol of the QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction. The RNA was eluted in 100 µl of buffer AVE (pre-warmed at 80oC). The eluted RNA was stored at -20oC until they were tested for BCoV using real-time polymerase chain reaction (RT-PCR).
PCR Product Generation
Detection of bovine CoV RNA was carried out using One-Step RT-PCR Kit (Qiagen, Hilden, Germany) and HCoV-OC43 primers. The following thermal protocol was used: reverse transcription at 50 °C for 30 min, Taq polymerase inactivation at 95°C for 15 min, 45 cycles of 95 °C for 15 secs, and 60 °C for 30 secs. Amplification results were acquired at 60°C. The total volume of the Qiagen one-step Master Mix was 25µl per sample comprised of RNAse-free water (10.5 µl); Onestep 5 x buffer (5 µl); dNTP (1 µl); Forward primer (1 µl); Reverse primer (1 µl); OC43 probe (0.5 µl); enzyme mix (1 µl) and the 5 µl of the RNA template. The oligonucleotide sequences of the forward and reverse primers used for the amplification were CGATGAGGCTATTCCGACTAGGT and CCTTCCTGAGCCTTCAATATAGTAACC respectively, and the probe sequence used was TCCGCCTGGCACGGTACTCCCT as previously described [26]. All RNA extracts were tested for host DNA to determine successful nucleic acid purification prior to use in PCR testing.
Purification of DNA products for sequencing
All bovine coronavirus positive samples were confirmed by means of 1-step reverse transcription-heminested PCR, using primers CoV2A-F (CTTATGGGTTGGGATTATCC) and CoV2A-R (TAATAACAGACAACGCCATCATC) for the first round and the inner primers CoV2A-Rnest a (CCATCATCACTCAGAATCATCA) and CoV2A-Rnest b (CCATCATCAGAAAGAATCATCA) as previously described [27]. This generated a 404-base pair amplicon from the RNA-dependent RNA polymerase (RdRp) gene (Additional file 1: Original uncroppped gel image). The detection and sequence analysis were based on the RdRp region because it is a highly conserved region which will facilate broad detection capability across the Betacoronavirus clade 2a.
The PCR products were then prepared for Sanger sequencing by mixing 5µL of the product with 2µL of ExoSAP-IT™ (Thermo Fisher, MA, USA) and incubated at 37oC for 15 minutes. After this, the mixture was incubated at 80oC for 15 minutes and then stored at 4oC until use. A volume of 3 µL of each of these cleaned products was then pipetted into 2 tubes and 6µL of RNAse-free water added to each tube. A volume of 1 µL of the forward primer was added to one tube and the same volume of nested reverse primers to the other tube to give a 10µL total volume per tube. Sanger sequencing was done by Seqlab GmbH, GÖttingen Germany.
All obtained sequences from Seqlab were compared to sequences deposited on GenBank via the BLAST Algorithm and were aligned together with reference sequences from the Genbank. A cladogram was constructed using Bayesian inference which compared the partial BCoV RdRp sequence obtained from this study to those from different species and countries.
Statistical Analysis
Categorical data were presented as frequencies (percentages). Analysis of sequence data was done using the online BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to identify homologous strains. Construction of the phylogenetic tree was done by Bayesian inference using MrBayes [28] plugin in Geneious Prime 2019 (http://www.geneious.com). Graphical presentation was performed using GraphPad Prism 7 version 7.04 (GraphPad Software, Inc., La Jolla, California USA).