The experiment was conducted in the growth room with controlled condition at the National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan. The seeds of hybrid maize cv. Zhengdan958 (ZD958) and Xianyu335 (XY335) were obtained from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China. The soil was collected from the 0–20-cm layer of an experimental field of NIBGE, and sieved through 2-mm mesh. The soil texture class was sandy loam with pH 7.46, 12.3 g kg− 1 organic matter, 13.05 mg kg− 1 total nitrogen, 6.52 mg kg− 1 available P, 98.72 mg kg− 1 exchangeable potassium. Seeds were surface sterilized in 70% ethanol for 1 min followed by 5% sodium hypochlorite for 5 min, then washed four times in deionized water and planted in plastic pots (20 cm in-depth, 16 cm in diameter) filled with 2 kg soil. In each pot, four seeds were initially sown and after emergence, one plant was maintained in each pot. Recommended fertilizer was applied in the soil before sowing including the levels of Phosphorus, P1 (100 mg P kg− 1 soil), P2 (50 mg P kg− 1 soil) and P3 (no phosphorus). The plants were allowed to be grow for 18 days at normal condition and then subjected to three different soil moisture regimes as, W1: well-watered (> 80%FC), W2: moderate drought stress (60% FC), W3: severe drought stress (40% FC) for 10 days. The average day-night temperature during the experiment period was 18–32°C and relative humidity was 60–70%, respectively. The plants were harvested at 28 DAS and growth parameters were recorded and fresh samples were taken for physiological and molecular parameters. All the treatments were arranged in a completely randomized design (CRD) with three replications for each treatment. The experimental treatments were re-positioned weekly to minimize the environmental effects.
Measurement Of Plant Growth Traits
At harvest, shoot length of maize seedlings was recorded with a meter scale and seedlings were further separated immediately into roots and shoots for the measurement of fresh weights using digital electric balance. Subsamples of shoots were stored at − 40°C for biochemical analysis. The root samples were carefully scanned using the Epson PerfectionV700 Photo Flatbed scanner (No. B11B178023, PT Epson, Jakarta, Indonesia) and root functional traits: total root length, root surface area, average diameter, and root volume, were analyzed using the WinRHIZO software (Regent Instructions, Quebec, Canada). Furthermore, the biomass allocation such as root mass fraction (the proportion of root dry weight to the total plant dry weight), the root/shoot ratio (ratio of the belowground biomass to the aboveground biomass), specific root length (length per unit dry weight of total root system), root mass density (mass per unit root volume) were analysed (Wen et al. 2020). Later, the samples were oven-dried for recording shoot and root dry weights.
Estimation Of Phosphorus Contents
The P contents from maize shoot and root samples was determined by vanadate molybdate method with some modifications using a UV/visible spectrophotometer as suggested by Chapman and Pratt (1962). One g of ground plant sample was taken for analysis and placed in a 100-mL volumetric flask, and 10 mL of tri-acid mixture (HNO3, H2SO4 and HClO with the ratio of 9:4:1) was added and the contents were mixed by swirling. The flask was placed on a hotplate in the fumehood and start heating at 80–90°C and then the temperature was raised to about 150–200°C. Continues heating were applied until the production of red NO2 fumes ceases. The contents were further heated until the volume was reduced to 3–4 mL and became colourless. After cooling the contents, the volume was made up with the distilled water and filtered through No. 1 filter paper. Then, 5 mL of digested solution was taken in a 50-mL volumetric flask, and 10 mL of vanadomolybdate reagent and make up the volume with distilled water. The absorbance of samples was observed by spectrophotometer to calculate the P content from the standard curve.
Measurement Of Ho And Lipid Peroxidation
The H2O2 contents were determined using the procedure described by Velikova et al. (2000). 500 mg of fresh leaves was homogenized with 5 mL of 0.1% (w/v) trichloro-acetic acid in pre-chilled pestle and mortar. The homogenate was centrifuged at 12,000 rpm for 15 min. Then, 0.5 mL supernatant was mixed in 0.5 mL of 0.05 M phosphate buffer (pH 7.0) + 1 mL of 1 M potassium iodide, and absorbance was recorded at 390 nm by using water as blank. The same steps were followed for making a standard curve by preparing different dilution of hydrogen peroxide.
Lipid peroxidation was quantified by the estimation of malondialdehyde (MDA) content using thiobarbituric acid assays (De Vos et al.1991). For analysis, fresh leaves (0.2 g) were placed on ice bath, grinded with 5.0 mL of 5% (w/v) TCA, centrifuged, and the MDA content was recorded at 532 and 600 nm spectrophotometrically.
Measurement Of Enzymatic Antioxidants
Leaf samples were harvested and kept in a disposable zipper bag and stored at -80°C for the determination of antioxidant enzyme activity. The activity of SOD was measured by following procedure of Dhindsa et al. (1981). For this, 200 mg leaf sample was homogenized in 2 mL of extraction buffer (0.5 mM EDTA + 0.1 M phosphate pH 7.5) with precooled mortar and pestle. The homogenate was centrifuged at 10,000 rpm at 4°C and supernatant was stored at 4°C. SOD activity in the supernatant was assayed by its ability to inhibit photochemical reduction of nitro blue tetrazolium. A 3 mL assay mixture containing (0.2 mL of 200 mM methionine + 1.5 M sodium carbonate + 0.1 mL 3 mM EDTA + 0.1 mL 2.25 mM NBT + 0.1 mL riboflavin (60 µM) + 1.5 mL 100 mM potassium phosphate buffer + 1 mL distilled water and 0.1 mL of enzyme) was incubated under two 15 W inflorescent lamps for 15 min; illuminated and nonilluminated reactions without supernatant served as calibration. Absorbance of the samples along with the blank was recorded at 560 nm wavelength in a spectrophotometer (UV-4000, ORI, Germany). One unit of SOD enzyme activity was defined as the quantity of enzyme that reduced the absorbance reading of samples to 50% in comparison with tubes lacking enzymes (supernatant). A 0.5 g of fresh leaves was ground in a 5 mL of 50 mM phosphate buffer (pH 7.8) with the help of pestle and mortar. The homogenates were centrifuged at 15000 rpm for 20 min at 4°C. The supernatant was used to assess peroxidase (POD) and catalase (CAT) activity. POD activity was determined by following procedure of Putter (1974) with slight modifications. The reaction mixture contained 10 mM guaiacol + 5 mM H2O2 and 50 mM phosphate buffer (pH 7.0). The reaction mixture was preheated at 20°C in a water bath. Then, 2.8 mL reaction solution + 0.2 ML enzyme was added in 10 mL centrifuged tube and mix thoroughly. Absorbance was recorded with blank and with reaction mixture. Four absorbance readings were recorded at 470 nm wavelength with 1 minute time interval using spectrophotometer (UV-4000, ORI, Germany).
CAT activity in fresh leaves was measured by the method of Aebei (1984) with slight modification. 100 mM H2O2 + 50 mM phosphate buffer (pH 7.8) solution was preheated in water bath at 25°C. In 10 mL tube, 0.2 mL phosphate buffer + 0.2 mL enzyme solution was added and preheated in water bath for 3 min. Then, 0.3 mL (100 mM H2O2) solution was added in 10 mL tube. The control tube was heated in boiling water bath for 5 min to kill the enzyme solution. After mixing, the absorbance at the 240 nm wavelength was calculated at interval of 1 min. Continuous determination for 4 min. 1 Unit of enzyme activity (U) was the decrease of 0.1 of A240 within 1 min.
Estimation Of Osmolyte Accumulation
Free proline contents were assessed by following the acid ninhydrin method (Shan et al. 2007). Fresh leaf material (0.5 g) was extracted using 5 mL of 3% sulfosalicylic acid for 10 min with shaking at 100°C. The 2mL of filtered aqueous extract was mixed with glacial acetic acid (2mL) and acid ninhydrin reagent (2 mL), and heated (100°C) for 30 min. The reaction mixture after cooling was segregated against toluene (4 mL) and the absorbance of the organic phase was recorded at 520nm. The resulting values were related with a standard curve plotted using known amounts of proline (Sigma, St Louis, MO, USA).
Total soluble sugar was estimated by anthracene ketone method as described by Zong and Wang. The fresh leaf sample (0.2 g) was homogenized with 25 mL distilled water and centrifuged (4000 rpm) for 20 minutes. Anthracene (0.1 g) was dissolved in 100mL diluted sulfuric acid to prepare anthracene sulfuric acid reagent. One mL extract and 5 mL anthracene sulfuric acid reagent were taken in a tube, shaken and put in boiling bath for 10 minutes. After 2 h stability, the sample was transferred in cuvette and the absorbance was read at 620 nm.
Total soluble proteins from the fresh leaf material were measured according to the Bradford (1976) method. 0.25 g fresh leaf material was grinding in 5 mL of phosphate buffer in chilled pestle and mortar, centrifuge at 12,000 rpm for 10 minutes and separated the supernatant. Then take 0.3 mL of supernatant and added 3 mL of Bradford reagent and gently mixed the solution and place it at room temperature for 10 min and absorbance of reading was taken at 595 nm using spectrophotometer.
Rna Isolation And Qrt- Pcr
RNA was extracted from maize tissue by using Trizol method with some modification. 1 µg RNA was reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). PowerUp™ SYBR™ Green Master Mix was used for the qPCR reaction using CFX96 qPCR thermocycler with the 100 ng of cDNA and 10uM/µl primers. α-tubulin gene primers were used as an internal control. Quantitative real-time PCR primer sequences for ZmTUB4, ZmPHR1.1, ZmPHR1.2 and ZmNAC111, are listed here in Table 1.
Table 1
List of qPCR primer sequences
Primer Name | | Primer sequence (5’-3’) |
ZmTUB4 | Forward | GCTATCCTGTGATCTGCCCTGA |
Reverse | CGCCAAACTTAATAACCCAGTA |
ZmPHR1.1 | Forward | GCCACAGGCGACAGATCTAA |
Reverse | CTCACCAATGGACTCACGGA |
ZmPHR1.2 | Forward | AAGGGCATTGGACACTGGAG |
Reverse | GTGAGGTGGTAGTGGAGTGC |
ZmNAC111 | Forward | CCAACGGTGTGAACAAGAGG |
Reverse | CCATGCCTCGAATCACTTGG |
Data analysis
The collected data were statistically analysed through analysis of variance technique using statistical package Statistix 8.1 (Analytical Software, Tallahassee, FL, USA). Mean variances were compared through Tukey’s HSD test (p < 0.05). Graphical presentation was done through Sigmaplot 10.0. and OriginPro 2021.