Cells, virus, and mice
The Vero E6 cell (Procell Life Science &Technology Co., Ltd, China) was cultured in Dulbecco's Modified Eagle Medium (DMEM; Procell Life Science &Technology Co., Ltd, China) supplemented with 10% fetal bovine serum (FBS; Biological Industries, Israel) and 1% penicillin-streptomycin solution (Procell Life Science &Technology Co., Ltd, China). Three mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All animal experiments were approved by the Committee on the Ethics of Animal Experiments of Chongqing Academy of Animal Sciences. The PEDV-SP-C strain was propagated and titrated in Vero E6 cells(Zhao et al. 2015).
Generation of full-length and truncated PEDV-S1S2J proteins
The S1S2J gene fragment (630-800aa) of spike protein gene sequences from PEDV AJ1102 strain (GenBank accession no. AFQ37598.1) was optimized, artificially synthesized and cloned into the pcDNA3.4 vector (Invitrogen, USA) to generate the S1S2J protein with a C-terminus mouse IgG2a Fc tag and a N-terminus 10×His tag. After transient expression in Expi293 suspension cells (Thermo Fisher Scientific, USA), the S1S2J fusion protein was enriched using a HisTrap HP column (GE Healthcare, USA) according to guidelines.
To determine the epitopes, the gene fragment of PEDV S1S2J was truncated into three segments with 45 bp overlap between neighboring parts and cloned into the pcDNA3.4 vector. The plasmids expressing truncated proteins fused to the Fc part of mouse IgG2a at C-terminus were transiently expressed in Expi293 suspension cells and enriched using a HiTrap Protein A HP affinity purification column. Protein concentration was ascertained using the A280 absorption value of Nanodrop2000 (Thermo Fisher Scientific, USA).
SDS-PAGE and Western blotting
The protein samples were mixed well with sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer and subjected to 12% SDS-PAGE electrophoresis. For SDS-PAGE staining, the protein gels were visualized by using Coomassie brilliant Blue staining (Beyotime, China). For Western blotting analysis, the proteins were transferred electrophoretically to a 0.45-μm PVDF Transfer Membrane (Thermo Fisher scientific, USA). After blocking in 5% skim milk for 2 h, the membranes were incubated with Alexa Fluor 680 donkey anti-mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody (Invitrogen, USA) (1:5000) for 2 h at room temperature. After being washed thrice with PBST, the membranes were imaged using the Licor Odyssey® CLX.
Preparation of PEDV-S1S2J antibodies
The method employed in this work is from our previous published paper(Yang et al. 2022). Briefly, three female BALB/c mice (6 weeks old) were immunised subcutaneously with 100 μg purified PEDV S1S2J protein in Freund's complete adjuvant (Sigma-Aldrich, USA). Three booster immunisations were performed at 2-week intervals with the same dose of S1S2J protein in Freund's incomplete adjuvant (Sigma-Aldrich, USA). The antibody titer of immunised mice serum was detected by enzyme-linked immunosorbent assay (ELISA) analysis. At 2 weeks after the final booster immunisation, a final intraperitoneal immunisation of the S1S2J protein was administered without an adjuvant. After 3 days, the spleen cells were isolated and fused to SP2/0 myeloma cells at a ratio of 5:1 using a bipolar pulsed electric field electrofusion method(Ke et al. 2019). Hybridoma cells were screened and monocloned by using the ClonaCell™-HY Hybridoma Cloning Kit (STEMCELL Technologies Inc). Positive clones were picked by ELISA coating with the S1S2J protein.
ELISA
An indirect ELISA was preformed to ascertain antibody titer of immunised mice serum or positive hybridoma cells. Briefly, the purified full-length S1S2J protein (2 µg/mL) was used to coat 96-well plates overnight at 4℃. After being washed thrice with PBST, the plates were blocked with 2% BSA for 2 h at 37℃. Then, diluted serum or hybridoma supernatant was added to plates and incubated for 1 h at 37 °C. After three washes, a 1:5000 dilution of anti-Mouse IgG (Fab specific)-peroxidase antibody produced in goat (Sigma-Aldrich, USA) was added to plates and incubated for 1 h at 37 °C. After five washing steps, the reacting results were visualised by using TMB (3,3′,5,5′-tetramethylbenzidine, Solabio), stopped via addition of 2 mol/L H2SO4. Absorbance at 450 nm was determined using a microplate reader (Epoch, BioTek Instruments, Inc.).
DNA sequencing of antibodies
Total RNA of hybridoma cells was isolated and the cDNA was synthesised with the PrimeScript™ One Step RT-PCR Kit (Takara, Japan). The target gene was amplified by PCR and analysed by Sanger sequencing. DNA sequencing of the light chain of antibodies were determined using a previously described method(Yan et al. 2017). To detect the isotypes of mouse immunoglobulin heavy chain, we designed several pairs of primers for the amplification. As shown in Table 1, the forward primers of the mouse immunoglobulin heavy chain located in a signal peptide of variable region, and the reverse primers located in CH2 regions of IgA, IgE, IgG, IgM or CH3 region of IgD. The subtypes of antibodies were detected by PCR with forward primers mixture and a reverse primer. After sequencing of PCR products, the subclasses analysis of antibodies was performed using the BLAST program.
Table 1 Primers
Primer Names
|
Sequences (5’-3’)
|
mVH-F-1
|
ATGGRATGSAGCTGKGTMATSCTCTT
|
mVH-F-2
|
ATGRACTTCGGGYTGAGCTKGGTTTT
|
mVH-F-3
|
ATGGCTGTCTTGGGGCTGCTCTTCT
|
mVH-F-4
|
CAGTCTGGACCTGAGCTGAAGAAGCCT
|
mVH-F-5
|
CAGTCTGGACCTGAGCTGGTGAAGCCT
|
mIGHA_CH2-R
|
CAGCTTTCTTCTGCACTGCATCCTT
|
mIGHE_CH2-R
|
GGTGAAGGTGCTTTCAGACATCCATT
|
mIGHG_CH2-R
|
ACCYTGCATTTGAACTCCTTGCC
|
mIGHM_CH2-R
|
CAGGTTCAGCCAGTCGATTTCAGAGA
|
mIGHD_CH3-R
|
CTGGTAGTCTCAGGACACTCCAGGT
|
Indirect immunofluorescence assay (IFA)
After infection with PEDV strains, obvious cytopathic effect (CPE) of Vero E6 cells was observed at 48 h. Then, the cells were fixed with 4% paraformaldehyde at room temperature for 30 min, followed by a block with 5% BSA at 37 °C for 1 h. Each hybridoma supernatant was added and incubated overnight at 4℃. After three washes, goat anti-mouse IgG H&L (FITC) (1:1000 dilution) (Abcam, UK) was added and incubated for 1 h at 37 °C. Images of the stained cells were visualized using an Inverted fluorescence microscope (DMi8, Leica Microsystems).
Flow cytometry analysis (FCA)
Monocellular suspensions of PEDV-infected Vero E6 cells were obtained after infection with PEDV strains for 48 h and incubated with hybridoma supernatant on ice for 1 h. After washed with 2% FBS-PBS (2% FBS in PBS) three times, the cells were stained with Goat Anti-Mouse IgG H&L (FITC) (1:1000 dilution) (Abcam, UK) for 30 min at 4℃. The cells were washed three times, resuspended in 2% FBS-PBS and detected by BD FACSVerseTM Flow Cytomerer. The data were analyzed using BD FACSuiteTM v1.0.6 software.
Statistical analysis
The GraphPad Prism 6.0 software was used for data analysis and processing.