Animals
All mice used in this study had a C57BL/6J genetic background and were housed under specific pathogen-free (SPF) conditions and kept at 20–26 ℃ under 12h:12h light-dark cycle and provide regular chow ad libitum and tap water during the experiment. The NG2 specific fluorescent mice (NG2-DsRed mice) and NG2 specific Cre-inducible cell lineage tracing mice (NG2-CreERT/Rosa26-STOP-floxed tdTomato-Tg [NG2-CreERT/Rosa TdTomato] mice) were generated as previously described [25, 26]. The NG2-specific Cre-inducible cell deletion mice (NG2-CreERT/DTA mice) were generated by crossing NG2-CreER mice and Rosa26-STOP-floxed-DTA-Tg mice [27]. Male mice (12–16 weeks of age) were used for all experiments. To induce Cre recombinase, mice were treated with Tam (Tamoxifen; Sigma-Aldrich, St. Louis, MO, USA) intraperitoneally at a dose of 100 mg/kg body weight (bw) for five days. For long-term observation (more than one month), additional Tam (100 mg/kg bw) was injected monthly to maintain PC deletion. Rosa26-STOP-floxed-DTA mice treated with Tam and NG2-CreERT/DTA mice treated with vehicle and corn oil were regarded as controls A and B, respectively. All animal experiments were performed in accordance with the ethical guidelines approved by the Animal Care and Use Committee of Asahikawa Medical University .
Physiological performance tests
Muscle strength was assessed using a grip-strength device (MK-380M; Muromachi Kikai Co., Tokyo, Japan). Mice were held by the tail and were made to grab the wire mesh of the grip-strength device with each limb. The mice were gently pulled away until the grip was released, and the maximal force was recorded. Ten measurements were performed 10 times for each mouse. Exercise tolerance was assessed using a treadmill test, with minor modifications to a published protocol [17]. Briefly, the mice were placed on the belt of a lane motorized treadmill (TMS-4B; MELQUEST, Toyama, Japan). After a warm-up period of 5 min (flat lane, belt speed of 10 m/min), the mice were run under the test conditions (+ 15° slope lane, 15 m/min), and the maximum running time was measured.
Histology and immunohistochemistry
To estimate functional vessels, mice were anesthetized with isoflurane (between 1.5 and 2.5%) to minimize suffering and injected with 300 µL of fluorescein isothiocyanate (FITC)- or rhodamine-labeled Griffonia simplicifolia lectin (500 µg/mL in PBS; Vector Laboratories, Burlingame, USA) before euthanasia, as described previously [25]. Euthanasia was performed by cardiac puncture under isoflurane anesthesia. Fresh muscle samples were embedded in a compound (Surgipath FSC 22 Blue; Leica Biosystems, Wetzlar, Germany), quickly frozen in liquid nitrogen, and stored at − 80 ºC until further use.
For histological analyses, 12-µm sections were obtained from frozen muscle using a cryostat (CM3050S; Leica Biosystems, Wetzlar, Germany) and fixed with 4% paraformaldehyde (PFA) in PBS (pH 7.0) for 5 min. Hematoxylin-eosin staining of the sections was performed using standard methods. Immunofluorescence analyses were conducted as previously described [17, 25]. Briefly, freshly frozen sections were fixed with acetone for 5 min at − 30°C. After air-drying, the samples were incubated with 0.3% Triton X-100 in PBS (PBST) with blocking buffer (1% bovine serum albumin [BSA] in PBST) for 60 min. Primary antibodies used were anti-myosin heavy chain type I (BA-D5-s, mouse monoclonal IgG2b, 1:10, DSHB, Iowa, USA), type IIA (SC-71-s, mouse monoclonal IgG1, 1:10, DSHB), type IIB (BF-F3-s, mouse monoclonal IgM, 1:10, DSHB), and anti-fast myosin skeletal heavy chain (ab91506, rabbit polyclonal, 1:100, abcam). Bound antibodies were visualized using following secondary antibodies: DyLight405-conjugated anti-mouse IgG 2b subclass-specific (115-475-207, goat polyclonal, 1:1000, Jackson, West Grove, PA, USA), specifically detect BA-D5, Alexa488-conjugated anti-mouse IgG1 subclass-specific (115-545-205,goat polyclonal, 1:1000, Jackson),specifically detect SC-71, Alexa647-conjugated anti mouse IgM subclass-specific(ab150123,goat polyclonal, 1:1000, abcam), specifically detect BF-F3, and Alexa 488-conjugated anti-rabbit IgG (A11008,goat polyclonal, 1:1000, invitrogen). Nuclei were stained with 4ʹ, 6-diamidino-2-phenylindole (DAPI; H-1200, VECTOR, CA, USA). Images were obtained using a fluorescence microscope (BZ-X710; Keyence).
To observe myofibers with microvessels in a 3D view, 50 µm longitudinal sections were fixed with 4% PFA and transparency using RapiClear 1.47 (RC147001, SunJin, Taiwan) was performed as described previously [25]. Clarified tissue sections were imaged using a confocal fluorescence microscope (LMS900; Carl Zeiss, Oberkochen, Germany), and 20–30 serial slides (40⋅) in 2-µm steps were z-stacked and projected onto a 3D image. Image analysis was performed using the BZ-X Analyzer (Keyence), ZEN blue (Carl Zeiss), and ImageJ software (ver.1.53c, National Institutes of Health, Maryland, USA).
Measurement of myonuclear domain
Isolation of single myofibers was performed with modifications to the previous description [28]. Briefly, after skeletal muscles were fixed with 4% PFA for 48 h, the muscles were incubated in a 40% NaOH solution for 2 h at 24 ℃ to isolate single myofibers. Muscle samples were then neutralized by soaking in 1 M Tris HCL solution (pH 6.0). The isolated myofibers were mounted on glass slides with 10% glycerol containing Hoechst 33342 (H3570; Invitrogen, Thermo Fisher Scientific, Waltham, MO, USA). Isolated myofibers were imaged using a fluorescence microscope (BZ-X710; Keyence), and the area of each myofiber and the number of nuclei within the fibers were measured.
Fluorescence in situ hybridization (FISH)
To detect NG2+ PC-originated myonuclei, the nuclei in which genetic recombination was induced by NG2 Cre were detected using PCR-FISH methods. To detect the Cre-specific genetic recombination site (tdTomato gene), the following primers were designed: forward primer, GGGCCCTAAGAAGTTCCTATTC; reverse primer, GGGGAAGGACAGCTTCTTGT. Myofibers were labeled by in situ PCR to synthesize digoxigenin (DIG)-labeled DNA using the PCR DIG Probe Synthesis Kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocol, with some modifications (denaturation at 95℃ for 40 s, annealing at 60°C for 20 s, and elongation at 72°C for 15 s). DIG-labeled probes were detected with an anti-DIG antibody (ab420, mouse monoclonal, 1:100, Abcam) and and visualized with Alexa 488-conjugated anti-mouse IgG antibody (A11029, goat polyclonal, 1:1000, Invitrogen).
In vitro myogenesis assay
After treatment with Tam for one week, soleus muscle fibers of NG2-lineage mice were isolated using collagenase I solution (100 mg/mL Hank’s PBS). Muscle fiber samples were incubated in a complete Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Thermo Fisher Scientific, Waltham, MO, USA) containing 20% fetal bovine serum (FBS; CORNING, Corning, NY), 100 U/mL penicillin, and 100 µg/mL streptomycin. After the cells were grown from fiber explants, the medium was switched to a differentiation medium—DMEM containing 2% horse serum (Gibco, Thermo Fisher Scientific, Waltham, MO, USA). After changing the medium every four days, myogenic differentiation was confirmed by observing myotube formation or immunostaining of MyHC.
In vitro cell viability assay
Adipose stromal cells (ASCs) were prepared from subcutaneous adipose tissues of the NG2CreERT/ DTA mice, and NG2 + cells were isolated using magnetic-activated cell sorting system as described previously [29]. Isolated cells (1.5×104 cells per well) were seeded on 12-well plates and incubated overnight, then treated with 2 µM 4-hydroxytamoxifen (4-HT; Sigma-Aldrich) or vehicle (DMEM with 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin) for 6 days. Cell numbers were counted in four high power fields for each well and the averages were compared.
Quantitative reverse-transcription (RT)-PCR
Total RNA was isolated from the soleus muscle or cultured cell samples using TRIzol™ Reagents (Thermo Fisher Scientific, Waltham, MO, USA). Complementary DNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Real-time quantitative RT-PCR was performed in triplicate using TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) on a LightCycler 480 System (Roche Diagnostics, Basel, Switzerland). The following fluorogenic probes and primers were used for detection: Mm99999915_g1 (Gapdh), Mm00507257_m1 (Cspg4/ NG2), Mm01354484_m1 (Pax7), Mm00435125_m1(Myf5), Mm00440387_m1 (Myod), Mm00446194_m1 (Myogenin), Mm01332564_m1 (Myh2), Mm01332541_m1 (Myh4), and Mm00600555_m1 (Myh7). The relative mRNA expression levels were calculated using the comparative threshold cycle method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control.
Gene microarray analysis
One month after treatment with Tam or the vehicle (corn oil), soleus muscles from each group of PC-deletion mice were dissected, frozen in liquid nitrogen, and stored at − 80°C. The mRNA of these samples was subjected to microarray analysis using the 3D Gene Mouse Oligo Chip 24 K (Toray Industries Inc., Tokyo, Japan), as described previously [15]. The signal corresponding to each gene was normalized using the global normalization method (Cy3/Cy5 ratio median = 1). Intensity values greater than two standard deviations above the background signal were considered valid. GO enrichment analysis was conducted using the metascape.org website.
Statistical analysis
Experimental data are presented as means ± standard error of the mean (SEM) unless otherwise noted. The sample numbers (n) are shown in the figure legends. Differences between two measurements were evaluated using the unpaired Student’s t-test, and for comparisons of more than two groups, one-way ANOVA was used for normal distributions. This was followed by Tukey’s post-hoc test using Prism software version 9.0 (GraphPad, San Diego, CA, USA). A P-value < 0.05 was considered statistically significant.