In silico analysis of transcription binding site motifs in endogenous and exogenous retroviruses emphasizes their conservation

doi:10.21203/rs.3.rs-2484770/v1

Download PDF

Research Article

In silico analysis of transcription binding site motifs in endogenous and exogenous retroviruses emphasizes their conservation

https://doi.org/10.21203/rs.3.rs-2484770/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

LTRs flanking the proviral genome in retroviruses are functionally divided into three regions: U3, R and U5. Transcription starts in the first nucleotide of the 5’ R and the region just upstream (5’ U3) contains sites which bind cellular factors and trigger transcription, known as TBS. Retroviruses may become endogenous when they infect germ cells, being transmitted throughout generations. In this review we have used the algorithm ALGGEN to analyze the presence of TBS in the U3 region of both endogenous and exogenous retroviruses. Exogenous retroviruses have included different gammaretroviruses (gibbon ape leukemia virus, GALV; murine leukemia virus, MuLV; koala retrovirus, KoRV and feline leukemia virus, FeLV). Endogenous retroviruses studied were related to FeLV (enFeLV). The most abundant TBS found were related to the immune response (adaptive and innate). Many TBS were arranged in clusters combining six or more overlapping sites, and polymorphisms mostly occurred outside the TBS. The number of TBS was similar in most LTRs analyzed. The analysis of TBS may explain the pathogenesis of each viral type. The high degree of conservation of TBS in endogenous sequences supports their importance.

LTR

transcription binding sites

endogenous retroviruses

exogenous retroviruses

Retroviruses are unique in many respects. One of them is that they reverse transcribe viral RNA into DNA which is integrated in the host genome (provirus). The proviral DNA is flanked by identical sequences on both ends, known as long terminal repeats or LTRs, which stretch for 300–600 nucleotides. They are formed by three regions (U3-R-U5) and contain enhancers, promoters, transcription initiation (capping), transcription terminator and polyadenylation signals. RNA transcription starts in the first nucleotide of the 5’ R (known as + 1), and the region just upstream (5’ U3) plays a key role in transcriptional regulation (1, 2). When the provirus integrates randomly in the host genome, it will remain throughout the life of the cell being inherited following Mendelian laws (3). It may remain latent without being expressed for an undetermined amount of time. Eventually, cellular factors generated when the cell receives specific stimuli cross the nuclear membrane and reach sensitive DNA sequences (called transcription factor binding sites or TBS), mostly in the cell genome, but also in the 5’ U3. This triggers RNA transcription by cellular RNA polymerase II. Some of these TBS respond to signals such as NF-κB (formed when the cell is activated by bacterial or viral antigens), steroids such as cortisol or progesterone (4) or other molecules formed following exposure to interferon (5, 6), amongst many other cellular signals. Additionally, LTR is usually a factor that contributes to the virulence and oncogenic potential of retroviruses, as several TBS may activate the expression of oncogenes nearby the integration site of the provirus (7).

Presently, the family Retroviridae is classified into two subfamilies, Orthoretrovirinae and Spumavirinae. In turn, subfamily Orthoretrovirinae contains six genera: Alpha-, Beta-, Gamma, Delta-, Epsilonretrovirus and Lentivirus (8). Gammaretroviruses are pathogenic viruses associated with neoplasia, immunosuppression and neurological disorders in many different species (9). Murine leukemia virus (MuLV) is the prototype in the genus, which also includes the gibbon ape leukemia virus (GALV), the koala retroviruses (KoRV) and the feline leukemia viruses (FeLV), amongst many others. The viruses mentioned infect somatic cells, such as leukocytes, and are transmitted contagiously within animals. The successful infection of the host by these gammaretroviruses in the long run produces a severe disease which may lead to death soon after the onset of clinical signs. Besides somatic cells, several of these gammaretroviruses (MuLV, KoRV, FeLV, GALV) as well as retroviruses of guinea-pigs, swine and humans may sporadically infect germ cells, (9–11). When this happens, the provirus, perpetuated in the germline, is passed onto the following generations and is said to have become endogenous. However, the controversy exists as whether exogenous retroviruses may have evolved from their endogenous counterparts (9). Through inheritance along the many generations, endogenous retroviruses (ERV) lose their genetic structure and become defective, so that generally they are not able to produce disease since they cannot replicate (10). However, a few endogenous retroviruses also retain their replication capacity (12, 13), may serve as a genetic pool with which exogenous retroviruses recombine, resulting in new viruses of undetermined pathogenicity and virulence (14–16), or through the LTR may participate in oncogenic processes.

The genome of cats and wild species of the genus Felis contains numerous endogenous retroviruses, including sequences with homology with FeLV, called endogenous FeLV or enFeLV (17, 18). The main differences between FeLV (hereinafter called exFeLV) and enFeLV are in the LTR and in gene env (19, 20) and some enFeLV are actively transcribed and translated (21). In fact, enFeLV could participate in the pathogenicity and disease in FeLV infections, as it has been shown that animals with higher genetic loads of enFeLV have greater viral replication rates than those with lower burden of enFeLV (20). It has also been shown that enFeLV may recombine with exFeLV, specifically with FeLV-A, giving rise to FeLV-B with different tropism and pathogenicity than FeLV-A (22, 23).

Though LTRs of endogenous retroviruses may have lost codifying regions during the evolution experienced along the centuries (24), remaining TBS may contribute to the pathogenicity of the exogenous counterparts or function as a promoter for itself or neighboring genes (25). Consequently, the aim of the present study was to compare the LTRs of enFeLV from eight FeLV-negative cats from the Central region of Spain with other LTRs from enFeLV and exFeLV available in GenBank. We have analyzed the TBS present in both groups to determine how these essential structures have changed throughout the generations. Our analysis expanded to other gammaretroviruses. We have observed a high degree of conservation in the TBS, reflecting their importance in the biology of the virus or the host, even when endogenized.

Cat samples and PCR amplification

Blood collected from the cephalic vein from eight cats born and raised in the Central Area of Spain was kindly donated by Dr. G. Miro from the Department of Animal Health of the Veterinary Faculty of UCM. All cats were diagnosed as negative for FeLV and feline immunodeficiency virus (FIV) infection based on the results of the Snap FeLV/FIV combo kit (Idexx). Genomic DNA was extracted from the blood samples (DNeasy Blood & Tissue Kit, Qiagen), the concentration measured by NanoDrop ND-200 (Themo Scientific), and stored at -20°C until used. Primers for LTR amplification were designed by us after comparison of published enFeLV and exFeLV sequences (Table 1). For the design, the 5’ and 3’ LTRs were assumed to be very similar if not identical, as was the case in the GenBank sequences used for comparison. The four primers selected were paired in three different ways as shown in Fig. 1, along with the expected amplicons. Amplified products were purified using GeneClean (Biogen) and sequenced in a local vendor (Secugen, Madrid) using the BigDye®Terminator v3.1. Both strands were sequenced at least twice. Definitive sequences were named C- followed by the number of the cat from which they derived (C-3, C-12, C-16, C-21, C-30, C-31, C-33, and C-34), and collectively called C-sequences.

Table 1

Primers used for LTR amplification and position in the genome of enFeLV AY364319. Fe60as and Fe90s hybridize to both 5’ and 3’ LTRs. s, sense; as, antisense.
Primer	Position in AY364319	SEQUENCE (5´-3´)
Fe54s	7999–8016	CGGGCTCTCATTGAATGGT
Fe60as	975–998 9088–9111	TGGGGAGACTTTTTATAGGGTTGG
Fe78as	1911–1932	AAAGAGGYKCGGGAGGATCTGT
Fe90s	601–621 8715–8735	TGAAAGACCCCTTCCCCTTGT

Analysis of sequences

Closely related sequences to the C-sequences were identified using the program Blastn. Clustal omega 2.0.12 (https://www.ebi.ac.uk/Tools/msa/clustalo/) was used for aligning sequences. The program Promo from ALGGEN (26) was used for detecting the TBS. Besides the enhancers TATA- and CAT-boxes, TBS searched for in this study are involved in the development of leukemia, the cell cycle, innate and adaptive immunity, response to hormones, and in neurological processes, and included AML-1, AP-1, AP-3, AP-4, C/EBP, CREB, Ets-1, Ets-2, GR, IRF-1, IRF-2, IRF-3, IRF-4, IRF-7A, ISGF-1, ISGF-3, Lvb, NF-1, NF-AT1, NF-AT2, NF-AT3, NF-AT4, NF-κB, Sp1, Sp3, STAT1, STAT1β, STAT3, STAT5A, STAT5B, STAT6, TBP.

TBS in other retroviral sequences were also analyzed to compare with those in C-sequences. Viral species chosen included different gammaretroviruses (enFeLV, ERV-DC, exFeLV, GALV, KoRV and MuLV) (Table 3). In addition, a search was performed in GenBank to find similar sequences in the cat genome. A comparison was done with sequence NC_018733 (length 90,186,660 bp) in the feline chromosome D2.

Complete LTRs were obtained from all eight cat samples. Their length and GenBank Accession Number are provided in Table 2.

Table 2

Length expressed in nucleotides and GenBank Accession Number of the LTR sequences of the FeLV-negative cats obtained in this study.
Code	Length (nt)	GenBank Accession Number
C-3	542	OP595717
C-12	541	OP595706
C-16	542	OP595709
C-21	542	OP595711
C-30	541	OP595707
C-31	541	OP595713
C-33	542	OP595715
C-34	538	OP595708

Table 2

Transcription binding sites (TBS) in several exogenous or endogenous retrovirus. TBS are arranged as factors related to the different aspects discussed below in the text (shown in bold). In each cell the digit represents the number of TBS or its range detected in the majority of genomes. Digits in parenthesis indicate the number of TBS in genomes exceptions to the majority.
	Gammaretrovirus
Factors	GALV	MuLV	KoRV	FeLV-A	FeLV-B	enFeLV	C-seq	ERV-DC
Leukemia
AML-1	1	1 (2)	1	1–2 (4)	1	0	0	1
LVb	1–2	1 (2)	1 (0)	1–2	1	2 (3)	2	0
Cell cycle
AP-1	1–2	0	1	0	0–1	2	2	0
AP-3	2	4	2	1–4	3–4	3	3	5
AP-4	0–1	1	0	0–1 (4)	1	0	0	0
NF-1	3–4	4–8	3–4	3–4 (11)	4	5–6 (4)	4–5	11
Ets-2	3–4	3	5	0–4	3–4	1 (5)	1	6
Sp1	0–2	0	0	1 (0)	1	0	0	0
Sp3	1–3	0	0	0	0	0	0	0
Innate immunity
IRF-1	2–3	1–3	1	0–1 (3)	1	3 (4)	3	2
IRF-2	0	0	0	0	0	0	0	0
IRF-3	2–3	1–3	1	0–1 (3)	1	3 (4)	3	2
STAT1	0–2	1	1	0 (2)	0	1	1	0
STAT1β	1–2	1 (2)	0	0	1	2	2	2
STAT5A	4–6	4 (5)	4	0–1 (3)	3–4	5 (6)	5	4
STAT5B	1–2	1 (2)	1	0–1	1	0	0	0
STAT6	2–3	1 (2)	1	1 (3)	0–1	1	1	1
Adaptive immune response
NF-AT1	4–6	2–6	2	0–2 (6)	2	6 (8)	6	2
NF-AT2	2–3	1–3	2	0–2 (4)	1–2	3 (4)	3	3
NF-AT3	1	1	0	0–1	0–1	1 (2)	1	0
NF-AT4	2	1 (2)	1	2	2	1–3	1 (2)	1
NF-κB	5 (1)	6 (2, 9)	1	1 (3)	1–2	4	4	1
Ets-1	4–6	6 (7)	5	6–8 (10)	8–9	6–8	6–7	6
Hormone stimulation
GR	0–2	3–5	0	2	2–3	0	0	0
GR-α	4–5	8–9 (12)	2–3	4	4	3–4 (5)	3–4	1
TATA and CAT boxes
C/EBP	8–10	5–8	11	3–6	6–7	6 (7)	6	12
TBP	3	3	4	2–3 (4)	3	2 (0)	2 (0)	2
Total range	61–90	74–98	58–61	50–83	66–67	66–84	66–70	60
Average	79.7	81.25	60	62.7	66.5	71.7	68.9	60
Number of sequences analyzed	3	4	3	8	2	7	8	1

The identity among the eight sequences was quite high (97.0%-99.8%). Blastn analysis showed that they were most closely related to the enFeLV sequences with GenBank Accession Numbers AY364319, LC196053, LC198317, MH270418, MH325047, and MH325035, all of them with percentage of identity above 98.4%. LTRs of C-sequences had a much lower similarity with FeLV-A and FeLV-B sequences (59.63%-61.2 5% and 60.68%-61.06%, respectively), lower than what has been reported for the whole genome (86%, (23)), and with the ERV-DC (45.98%-46.96%) than with enFeLV LTRs (manuscript in preparation). Consequently, C-sequences were considered enFeLV.

Sixty-six to seventy TBS were identified in the C-sequences (Table 3). TBS with a higher presence in the C-LTRs were Ets-1 (six or seven sites), NF-AT1, C/EBP (six sites each), and NF-1 and STATA5A (four or five sites each) (Table 3). TBS not found in the C-sequences LTR were AML-1, AP-4, CREB, GR, IRF-2, Sp1, Sp3, STAT3 and STAT5B. Transcription binding sites were very conserved and polymorphisms affected mostly the surrounding nucleotides of the TBS (Figure S1). However, when compared to other enFeLV, some TBS had been lost through genome variation. For example, enFeLV LC196053 had a total of 84 TBS, while C-sequences had 66–70 TBS, as most other enFeLV (Table 3). The sequence in the feline chromosome D2 had the same number and distribution of TBS as AY364318 and AY364319 (Figure S1). In general, in several cases when changes affected TBS, genetic changes created other TBS, suggesting that the number and type of TBS were important for the biology of either the viral sequence or the host. The integrity of most TBS in enFeLV LTRs including the C-sequences and their great resemblance to those in exFeLV may suggest that their presence is necessary for the virus or the cat.

This prompted us to compare the presence of TBS in different gammaretroviral strains, both exogenous and endogenous. Exogenous FeLV, including FeLV-A (eight sequences) and the FeLV-A/enFeLV recombinant FeLV-B (two sequences), to which enFeLV are closely related, were chosen to determine whether the endogenization process involved modification in the number and type of TBS. Other gammaretroviruses chosen (three or four sequences for each one) were the murine leukemia virus (MuLV), as it has been suggested that enFeLV may be related to MuLV, acquired from the predation of rodents by felids in the ancient past (20), koala retrovirus (KoRV, which may have been recently endogenized (27)), gibbon ape leukemia virus (GALV), and other feline endogenous retrovirus of the domestic cat (ERV-DC, unrelated to enFeLV (12)) (Table 3). Putative TBS were located using the algorithm ALGGEN, which identified sites with some degree of variability.

The type and number of TBS in enFeLV was most similar to that of GALV (66–84 and 61–90, respectively). The number of TBS in KoRV was the lowest of the gammaretroviruses analyzed (58–61).

Analysis of TBS present in the selected LTRs

Since TBS affect different aspects of the cell biology, they will be discussed in groups. However, their effects are pleiotropic, and any one of them is present in promoters of genes which encode proteins which participate in different cellular events.

TATA and CAT boxes

The well-known promoters TATA-box and CAT-box were present in all the C-sequences as TATAA from − 23 to -27 bp and CCAAT from − 84 to -88 bp, except in C-30, which lacked both. These promoter sequences are located in highly conserved areas, as they are necessary to start the activity of the machinery responsible for replication. Of the 36 sequences analyzed, the TATA-box was only missing in C-30 and in AB6444 (feline ERV-DC). Consequently, these two LTR sequences were also missing the TBP (TATA-box binding protein) site, which greatly overlaps the TATA-box. TBP and some additional proteins associated to it constitute the TFIID complex, a general transcription factor that forms part of the pre-initiation complex of the RNA polymerase II, as it positions this enzyme on the start site for gene transcription (28). CCAAT was not as conserved, and it was missing from the ERV-DC. Regardless of the presence or absence of the CCAAT, all 36 sequences analyzed had at least one C/EBP (CCAAT/Enhancer-binding protein), most of them between six and 12 sites (Table 3). Their position in the LTR was very conserved: two or more sites were frequently located in the immediacies of the CAT-box, around − 80 bp (Fig. 3), as expected. C/EBPs play key roles in regulating cellular growth and differentiation through interaction with cell cycle proteins, immune and inflammatory responses, as well as having a specific role within the context of various disease processes (29) and have been described as both tumor promoters and tumor suppressors (30).

Factors related to leukemia

One of the most striking differences between exFeLV and enFeLV (including the C-sequences) was the presence of 1–2 (exceptionally 4: AB060732) AML (acute myeloid leukemia)-1 sites in exFeLV vs none in the enFeLV. AML-1 sites were also present in all exogenous gammaretroviruses. AML is a protein that participates in hematopoiesis and has a primary role in the development of all hematopoietic cell types. On the other hand, the other TBS related to leukemia (LVb, leukemia virus factor b) was virtually present in all gammaretroviruses (except for one KoRV), both exogenous and endogenous, in a well-preserved region. Nevertheless, LVb is thought to induce leukemia in combination with other TBS, 5’-LVb/core/NF1/GRE-3’. This tandem sequence is highly conserved in a large number of murine, feline and primate C-type retroviral enhancers (31), but was missing from endogenous retroviruses, as none of them had a GRE site (see below); thus, probably LVb was inactive in these LTRs, annulling their leukemogenic potential.

Factors related to cell differentiation, proliferation and apoptosis

There are many TBS which participate in cellular processes related to cell differentiation, cell growth, proliferation, apoptosis, response to DNA damage and chromatin remodeling. Many of them were present in variable numbers in the LTRs analyzed.

exFeLV had no (or exceptionally one) AP (activating protein)-1 sites, vs two in enFeLV LTRs. The algorithm ALGGEN did not locate any AP-2 site in any of the sequences, which is surprising as it plays a critical role in regulating gene expression during early development (32). However, using other algorithms AP-2 motif was found to be conserved in FeLV-A (33) and maybe that ALGGEN cannot locate AP-2 correctly. The AP factors regulate gene expression in response to a variety of stimuli, including cytokines, growth factors, stress and bacterial and viral infections (34). No endogenous retrovirus had any AP-4 site (the symmetrical DNA sequence 5’-CAGCTG-3’). AP-4 acts both as a repressor and an activator of different target genes, both viral and cellular, by binding to their E-box sequence in the promoters (35).

Other TBS related to cell growth is the NF (nuclear factor)-1. In the LTRs studied, this site had some mutations, coinciding with what is described in the literature, and it is possible that some of them affect transcription in a cell-specific way (36). It was very abundant in all gammaretroviruses with 4–5 representations in each virus, and one of the FeLV-A LTRs (AB060732) had 11. It was also numerous in some of the MuLV (Table 3). Most of the sites present at -150 bp or less were in the close neighborhood of C/EBP and TBP sites, suggesting a collaboration of these sites in transcription.

The Sp family of transcription factors binds to GC/GT rich motifs of many promoters to regulate the expression of multiple genes involved in many cellular processes, from differentiation to apoptosis (37). ALGGEN located this TBS in exFeLV (in accordance with data from (33)) and in GALV. In exFeLV, Sp1 and C/EBP sites were over 60 bp apart, which may abrogate the possibilities of interaction between them (38).

Ets-2 transcription factor regulates genes involved in development and apoptosis. In the LTRs analyzed Ets-2 was absent only from two FeLV-A sequences, and was most abundant in KoRV (five sites), while all the other LTRs had 1–4 (Table 3).

Factors related to response to interferon and other innate mechanisms

Interferon is a molecule of the innate immune response that has several effects. Inducible expression of the type I interferon (IFN-I) genes is controlled through multiple TBS within these genes, the interferon regulatory factors or IRFs and the interferon stimulated response elements or ISREs (reviewed in (39, 40)), which function as enhancers to promote transcriptional induction by alpha/beta interferons (IFN-I). IRF-1 and − 3 were well-represented in most LTRs analyzed. The highest number was observed in the endogenous retroviruses (enFeLV), while the lowest in their exogenous counterparts (Table 3). ISRE was not searched for in this work.

The family of proteins STAT (Signal Transducer and Activator of Transcription) also participate in processes of proliferation, immunity, apoptosis and cell differentiation (41). We have included them in this group of TBS related to innate immunity as STAT1 is involved in IFN-I signaling (42). All strains had at least one STAT1 or STAT1β site (Table 3). TBS that recognize STAT5, involved in hematopoiesis and with a role in leukemia (43), were very numerous in most viruses; exFeLV, which produce lymphoma and leukemia in a high percentage of animals (44), had the lowest number of this TBS (Table 3).

Factors related to adaptive immune response

The number of NF-AT (nuclear factor of activated T-cells) sites was radically different between the viruses studied. Six to eight NF-AT1 sites were present in enFeLVs vs none to two in exFeLV, though one FeLV-A (MF681672) had six. NF-AT2 was also higher in enFeLV (three or four sites) than in exFeLV (no or two in exFeLV, though MF681672 had four). Differences in the number of NF-AT3 and NF-AT4 were not so marked (Table 3). NF-AT is a family of transcription factors important in the immune response. They were first discovered as an activator for the transcription of interleukin-2 (IL-2) in T-cells, a regulator for T-cell response, but has since been found to participate in the regulation of many other body systems (45). NF-AT is known to bind its site in a cooperative complex with AP-1, and the activation of both is known to trigger the genes for cytokines and chemokines, required for a productive immune response (46). NF-AT and AP-1 are close enough to cooperate in GALV, KoRV, one FeLV-B (MH116005) and enFeLV.

NF-κB (nuclear factor kappa B) also regulates the immune response and it is involved in the cell response to many stimuli, such as stress, cytokines, UV rays, and viral and bacterial antigens (47). It is an enhancer for the synthesis of the kappa light chains of the immunoglobulins by B-cells, and also regulates genes involved in the development, maturation and proliferation of T-cells (48). The LTRs analyzed exhibited big differences between them. All gammaretroviruses had at least one NF-κB, enFeLV had 4–5 NF-κB, but exFeLV only had 1–2 (Table 3).

Ets-1 is expressed at high levels mainly in tissues related to the immune response such as thymus, spleen and lymph nodes and may block differentiation of B- and T-cells (49, 50). The presence of the Ets-1 TBS as identified by ALGGEN was numerous but very variable, even within different LTRs of the same species.

Factors related to hormone stimulation

The retroviruses with the highest number of glucocorticoid response element (GR) and GR-alpha TBS were MuLV (Table 3). The relationship between retroviruses and glucocorticoids (GC) was first reported when it was discovered that GC stimulated the expression and budding of mouse mammary tumor virus (MMTV) (51). MuLV, a gammaretrovirus, is distantly related to MMTV, a betaretrovirus, but it is interesting that MuLV, as MMTV, had an overrepresentation of GR when compared to the other viruses studied. GR also responds to progesterone, androgens and mineralcorticoids (52), so the array of situations which may affect MuLV expression through this site is notable, and are associated to development, metabolism and even immune response. exFeLV also had two or three GR sites, vs none in enFeLV (Table 3). The similarity between the number of GR sites in MuLV and in exFeLV again may represent the acquisition of an ancestral rodent virus by a felid predecessor (20), but which may have only endogenized when mutations in this site would have abrogated its function.

Differences in the U3 regions of the LTRs of enFeLV and exFeLV

The conservation of these regions in enFeLV does not mean that the TBS are functional, but it would highlight their importance in the transcription machinery of these viruses. Some of the mechanisms that may abrogate the functionality of TBS are the methylation and subsequent deamination of CpG dinucleotides, which alter the binding sites of transcription factors (53), mutations and deletions (54). A TBS search with ALGGEN of a 26-nt and 13-nt deletions in all the C-sequences and the sequence in feline chromosome D2 compared to AY364318 and AY364319, respectively, and a 21-nt deletion also present in the same area of exFeLV compared to AY364318 (Fig. 1S) indicated that this area did not contain TBS. Thus, the indel had occurred in an area of the LTR potentially irrelevant for transcription. Because the C-30 sequence was the least homologous to the other enFeLV sequences (Fig. 1S), we studied the presence of its TBS separated from the other C-sequences. The analysis showed that the TBS were very similar to those in the other C-sequences, except that an NF-1 site had disappeared in C-30 that in all other C-sequences is located from nucleotide − 303 to -308.

Distribution of TBS within the U3 regions

When analyzing the distribution of TBS in the different LTRs, "hot spot" regions with six or more overlapping TBS were detected in all of them (Figs. 2 and 3). For example, the C-sequences and the other enFeLV had three of those clusters, at nucleotides − 372 to -365 (cluster of 10 TBS), at -313 to -305 (cluster of 12 TBS), and at -295 to -290 (cluster of 12 TBS). All three clusters included many TBS related with innate and adaptive immunity. The clustering of TBS may be a consequence of cooperation between sites as stated above for the LVb/core/NF1/GRE and NF-AT/AP-1.

In conclusion, a similar number and type of TBS were found in feline enFeLV (including 8 C-sequences from Spanish cats and an LTR-like sequence in the feline chromosome D2) and exFeLV LTRs. The study benefits from the existence of enFeLV, very closely related to exFeLV, making comparisons between both very interesting. The integrity of most TBS in enFeLV LTRs and their great resemblance to those present in exFeLV may suggest that they may work as regulatory elements in cis to control the expression of multiple genes. A similar number and type of TBS were also found in other gammaretroviruses that affect different species (GALV, MuLV, KoRV). A high degree of conservation in some TBS was observed in most of the viruses studied, even in the endogenous forms, which could be related to the biology and the replication strategies of these viruses or to the evolutionary adaptation to the cellular host. However, the presence of a particular TBS in the endogenous retroviral sequences does not necessarily mean that they can respond to cellular factors or signals or could even represent a potential risk in case of infection with exogenous retrovirus homologs. To determine whether the TBS of endogenous sequences are actually functional, additional analyses should be performed studying the expression of messenger RNA, from which the functional protein would be synthesized, after stimulating the host cell or after cloning in a vector.

Supplementary Information The online version contains supplementary material available at… , which includes Location of TBS in C-sequences and other enFeLV, FeLV-A and FeLV-B.

Author contributions EGL and AD conceived the study. JO performed the experiments. EGL, AD and LB analyzed the data. EGL drafted the manuscript. All authors reviewed and improved de manuscript and approved the final version.

Acknowledgments The authors are indebted to Dr. Guadalupe Miro (Department of Animal Health, Faculty of Veterinary Medicine, Complutense University of Madrid) for her kind donation of blood samples. This manuscript is dedicated to David A. Bruhn, recently deceased. His revision and comments on a draft version significantly improved it. May he rest in peace.

Funding This research was partially funded by PR26/16-20306 (BSCH-UCM) Characterization of feline endogenous retrovirus and feline leukemia virus (FeLV): implications in the evolution of new viral strains, by the UCM Research Group 920620, and by Bioassays.

Data availability All data presented in this study are available from the corresponding author upon reasonable request.

Conflict of interest The authors declare no conflict of interest.

Clements JE, Zink MC. Molecular biology and pathogenesis of animal lentivirus infections. Clin Microbiol Rev. 1996 Jan;9(1):100–17.
Pépin M, Vitu C, Russo P, Mornex JF, Peterhans E. Maedi-visna virus infection in sheep: a review. Vet Res. 1998 Aug;29(3–4):341–67.
Gomez-Lucia E. Chapter 00005 - Retroviridae Animal Lentiviruses | Elsevier Enhanced Reader [Internet]. 2020 [cited 2020 Jul 31]. Available from: https://reader.elsevier.com/reader/sd/pii/B9780128145159000059?token=B3F4B8E9C293FE1828460C136939F4DECE64B3F71C4704CEE102142789834EE59BA6A173814879D4DC8E312D569D48D0
Gomez-Lucia E, Sanjosé L, Crespo O, Reina R, Glaria I, Ballesteros N, et al. Modulation of the long terminal repeat promoter activity of small ruminant lentiviruses by steroids. Vet J. 2014 Nov;202(2):323–8.
Pluta A, Jaworski JP, Cortés-Rubio CN. Balance between Retroviral Latency and Transcription: Based on HIV Model. Pathogens. 2020 Dec 29;10(1):16.
Russo FO, Patel PC, Ventura AM, Pereira CA. HIV-1 long terminal repeat modulation by glucocorticoids in monocytic and lymphocytic cell lines. Virus Res. 1999 Oct;64(1):87–94.
Lamprecht B, Bonifer C, Mathas S. Repeat element-driven activation of proto-oncogenes in human malignancies. Cell Cycle. 2010 Nov;9(21):4276–81.
ICTV. International Committee on Taxonomy of Viruses ICTV [Internet]. 2019. Available from: https://talk.ictvonline.org/taxonomy/
Murphy B. Retroviridae. In: Fenner’s Veterinary Virology [Internet]. Elsevier; 2017 [cited 2019 Aug 3]. p. 269–97. Available from: https://linkinghub.elsevier.com/retrieve/pii/B9780128009468000143
Greenwood AD, Ishida Y, O’Brien SP, Roca AL, Eiden MV. Transmission, Evolution, and Endogenization: Lessons Learned from Recent Retroviral Invasions. Microbiol Mol Biol Rev. 2018;82(1).
Meyer TJ, Rosenkrantz JL, Carbone L, Chavez SL. Endogenous Retroviruses: With Us and against Us. Front Chem. 2017;5:23.
Kawasaki J, Nishigaki K. Tracking the Continuous Evolutionary Processes of an Endogenous Retrovirus of the Domestic Cat: ERV-DC. Viruses. 2018 06;10(4).
Kuse K, Ito J, Miyake A, Kawasaki J, Watanabe S, Makundi I, et al. Existence of Two Distinct Infectious Endogenous Retroviruses in Domestic Cats and Their Different Strategies for Adaptation to Transcriptional Regulation. J Virol. 2016 15;90(20):9029–45.
Anai Y, Ochi H, Watanabe S, Nakagawa S, Kawamura M, Gojobori T, et al. Infectious endogenous retroviruses in cats and emergence of recombinant viruses. J Virol. 2012 Aug;86(16):8634–44.
Tury S, Giovannini D, Ivanova S, Touhami J, Courgnaud V, Battini JL. Identification of Copper Transporter 1 as a Receptor for Feline Endogenous Retrovirus ERV-DC14. J Virol. 2022 Jun 22;96(12):e0022922.
Chiu ES, McDonald CA, VandeWoude S. Endogenous Feline Leukemia Virus (FeLV) siRNA Transcription May Interfere with Exogenous FeLV Infection. Simon V, editor. J Virol. 2021 Nov 9;95(23):e00070-21.
Roca AL, Pecon-Slattery J, O’Brien SJ. Genomically intact endogenous feline leukemia viruses of recent origin. J Virol. 2004 Apr;78(8):4370–5.
Tandon R, Cattori V, Willi B, Meli ML, Gomes-Keller MA, Lutz H, et al. Copy number polymorphism of endogenous feline leukemia virus-like sequences. Mol Cell Probes. 2007 Aug;21(4):257–66.
Stewart H, Jarrett O, Hosie MJ, Willett BJ. Are endogenous feline leukemia viruses really endogenous? Vet Immunol Immunopathol. 2011 Oct 15;143(3–4):325–31.
Tandon R, Cattori V, Pepin AC, Riond B, Meli ML, McDonald M, et al. Association between endogenous feline leukemia virus loads and exogenous feline leukemia virus infection in domestic cats. Virus Res. 2008 Jul;135(1):136–43.
Shimode S, Nakagawa S, Miyazawa T. Multiple invasions of an infectious retrovirus in cat genomes. Sci Rep. 2015 Feb 2;5:8164.
Cano-Ortiz L, Tochetto C, Roehe PM, Franco AC, Junqueira DM. Could Phylogenetic Analysis Be Used for Feline Leukemia Virus (FeLV) Classification? Viruses. 2022 Jan 26;14(2):249.
Erbeck K, Gagne RB, Kraberger S, Chiu ES, Roelke-Parker M, VandeWoude S. Feline Leukemia Virus (FeLV) Endogenous and Exogenous Recombination Events Result in Multiple FeLV-B Subtypes during Natural Infection. Simon V, editor. J Virol [Internet]. 2021 Aug 25 [cited 2021 Dec 9];95(18). Available from: https://journals.asm.org/doi/10.1128/JVI.00353-21
Roca AL, Nash WG, Menninger JC, Murphy WJ, O’Brien SJ. Insertional polymorphisms of endogenous feline leukemia viruses. J Virol. 2005 Apr;79(7):3979–86.
Shimode S, Yamamoto T. Characterization of DNA methylation and promoter activity of long terminal repeat elements of feline endogenous retrovirus RDRS C2a. Virus Genes. 2022 Feb;58(1):70–4.
Farre D, Roset R, Huerta M, Adsuara JE, Roselló L, Albà MM, et al. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Research. 2003 Jul 1;31(13):3651–3.
Tarlinton RE, Meers J, Young PR. Retroviral invasion of the koala genome. Nature. 2006 Jul 6;442(7098):79–81.
Kingsman SM, Kingsman AJ. The Regulation of Human Immunodeficiency Virus Type-1 Gene Expression. Eur J Biochem. 1996 Sep 15;240(3):491–507.
Liu Y, Nonnemacher MR, Wigdahl B. CCAAT/enhancer-binding proteins and the pathogenesis of retrovirus infection. Future Microbiology. 2009 Apr;4(3):299–321.
Nerlov C. The C/EBP family of transcription factors: a paradigm for interaction between gene expression and proliferation control. Trends in Cell Biology. 2007 Jul;17(7):318–24.
Hopkins N, Golemis E, Speck N. Role of enhancer regions in leukemia induction by nondefective murine C-type retroviruses. In: Concepts in viral pathogenesis III. Springer Verlag; 1989. p. 41–9.
Hilger-Eversheim K, Moser M, Schorle H, Buettner R. Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and cell-cycle control. Gene. 2000 Dec;260(1–2):1–12.
Bande F, Arshad SS, Hassan L, Zakaria Z. Molecular detection, phylogenetic analysis, and identification of transcription motifs in feline leukemia virus from naturally infected cats in malaysia. Vet Med Int. 2014;2014:760961.
Hess J. AP-1 subunits: quarrel and harmony among siblings. Journal of Cell Science. 2004 Dec 1;117(25):5965–73.
Aranburu A, Carlsson R, Persson C, Leanderson T. Transcription factor AP-4 is a ligand for immunoglobulin-κ promoter E-box elements. Biochemical Journal. 2001 Mar 1;354(2):431–8.
Jackson ML, Haines DM, Misra V. Sequence analysis of the putative viral enhancer in tissues from 33 cats with various feline leukemia virus-related diseases. Veterinary Microbiology. 1996 Dec;53(3–4):213–25.
Chen X, Zhang Q, Bai J, Zhao Y, Wang X, Wang H, et al. The Nucleocapsid Protein and Nonstructural Protein 10 of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Enhance CD83 Production via NF-κB and Sp1 Signaling Pathways. Pfeiffer JK, editor. J Virol. 2017 Sep 15;91(18):e00986-17, e00986-17.
Goldhar AS, Duan R, Ginsburg E, Vonderhaar BK. Progesterone induces expression of the prolactin receptor gene through cooperative action of Sp1 and C/EBP. Molecular and Cellular Endocrinology. 2011 Mar;335(2):148–57.
Gómez-Lucía E, Collado VM, Miró G, Doménech A. Effect of type-I interferon on retroviruses. Viruses. 2009;1(3):545–73.
Ivashkiv LB, Donlin LT. Regulation of type I interferon responses. Nat Rev Immunol. 2014 Jan;14(1):36–49.
Lim CP, Cao X. Structure, function, and regulation of STAT proteins. Mol BioSyst. 2006;2(11):536.
Gao B, Wang H, Lafdil F, Feng D. STAT proteins – Key regulators of anti-viral responses, inflammation, and tumorigenesis in the liver. Journal of Hepatology. 2012 Aug;57(2):430–41.
Maurer, Kollmann, Pickem, Hoelbl-Kovacic, Sexl. STAT5A and STAT5B—Twins with Different Personalities in Hematopoiesis and Leukemia. Cancers. 2019 Nov 4;11(11):1726.
Hartmann K, Hofmann-Lehmann R. What’s New in Feline Leukemia Virus Infection. Veterinary Clinics of North America: Small Animal Practice. 2020 Sep;50(5):1013–36.
Pan MG, Xiong Y, Chen F. NFAT Gene Family in Inflammation and Cancer. CMM. 2013 Apr 1;13(4):543–54.
Macián F, López-Rodríguez C, Rao A. Partners in transcription: NFAT and AP-1. Oncogene. 2001 Apr;20(19):2476–89.
Platanitis E, Decker T. Regulatory Networks Involving STATs, IRFs, and NFκB in Inflammation. Front Immunol. 2018 Nov 13;9:2542.
Brown KD, Claudio E, Siebenlist U. The roles of the classical and alternative nuclear factor-kappaB pathways: potential implications for autoimmunity and rheumatoid arthritis. Arthritis Res Ther. 2008;10(4):212.
John S, Russell L, Chin SS, Luo W, Oshima R, Garrett-Sinha LA. Transcription Factor Ets1, but Not the Closely Related Factor Ets2, Inhibits Antibody-Secreting Cell Differentiation. Molecular and Cellular Biology. 2014 Feb 1;34(3):522–32.
Mouly E, Chemin K, Nguyen HV, Chopin M, Mesnard L, Leite-de-Moraes M, et al. The Ets-1 transcription factor controls the development and function of natural regulatory T cells. The Journal of Experimental Medicine. 2010 Sep 27;207(10):2113–25.
Smoller CG, Pitelka DR, Bern HA. Cytoplasmic inclusion bodies in cortisol-treated mammary tumors of C3H/Crgl mice. J Biophys Biochem Cytol. 1961 Apr 1;9(4):915–20.
Tejerizo G, Domenech A, Illera JC, Collado VM, Gomez-Lucia E. Effect of 17beta-estradiol and progesterone on the expression of FeLV in chronically infected cells. Vet Microbiol. 2005 Aug 30;109(3–4):191–9.
Manghera M, Douville RN. Endogenous retrovirus-K promoter: a landing strip for inflammatory transcription factors? Retrovirology. 2013 Dec;10(1):16.
Stewart H. The evolution of novel subgroups of feline leukaemia virus. [Internet]. University of Glasgow; 2013. Available from: http://theses.gla.ac.uk/3799/

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

In silico analysis of transcription binding site motifs in endogenous and exogenous retroviruses emphasizes their conservation

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cat samples and PCR amplification

Analysis of sequences

Results And Discussion

Analysis of TBS present in the selected LTRs

TATA and CAT boxes

Factors related to leukemia

Factors related to cell differentiation, proliferation and apoptosis

Factors related to response to interferon and other innate mechanisms

Factors related to adaptive immune response

Factors related to hormone stimulation

Differences in the U3 regions of the LTRs of enFeLV and exFeLV

Distribution of TBS within the U3 regions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1