Cell Lines and Culture Conditions. Cell lines were cultured in a humidified atmosphere containing 10% CO2 in Dulbecco’s Modified Eagle’s Medium (Mediatech, Inc.) supplemented with 10% fetal bovine serum (Atlanta Biologicals). Cell types used; HT1080-LXSN (human fibrosarcoma cells expressing empty vector LXSN), NARF2 (osteosarcoma), MDA MB 468 (breast cancer).
For adenoviral transduction, 2000–4000 NARF2 or 2000–3000 HT1080 cells or 8,000 MDA MB 468 cells were plated per well into 24 well plates throughout the study. Next day, cells were infected with viruses and one day later, fresh media was replaced. Drugs were added 48-72h post adenoviral infection. Cells were stained 1–3 days later with a saturated solution of methylene blue in 50% ethanol. Plates were rinsed and retained dye quantified by spectrophotometry. Absorbance was normalized to DMSO and given as 1 or 100% for cell viability. Some of the experiments were carried out with MTT assay (indicated at the appropriate places). We have recently shown that, in the context of ferroptosis, methylene blue staining results are very similar to MTT assay [6]. Results are representative of at least two independent experiments. Statistical significance was assessed using the students t-test. All commercially available chemicals were obtained from Cayman Chemicals unless otherwise noted. Novel compound CETZOLE 1 was synthesized as we have described in [4].
MTT assay. 12 mM MTT (Goldbio) stock solution (10 X) was prepared in 1X PBS. For 24 well plates, at the harvesting time, media was replaced with 300 µl fresh media. 30 µl of MTT stock solution was added and incubated at 37℃. After 3 hours, equal amount of MTT lysis solution (0.01N HCl in 10% SDS) was added and incubated for 30 minutes. Finally, absorbance was measured at 540 nm.
Generation of RB adenoviruses and purification. First generation of RB adenoviruses were constructed and generated using AdEasy1 system. WT RB and RBΔCDK ORF were cloned from the plasmids constructed in Dowdy lab using the following primers (5” to 3”); forward primer-ACCGTCGACGCGGCCGCCACCATGTACCCATACG and reverse primer-TAGGCTCGAGCGGCCTCATTTCTCTTCCTTGTTTG. Next, the PCR amplicon was inserted into PmeI and EcoRI linearized shuttle vector AdTrack-CMV was a generous gift from Bert Vogelstein (Addgene plasmid # 16405; http://n2t.net/addgene:16405 ; RRID:Addgene_16405) using infusion cloning kit (Takara) [37]. Then, colonies were isolated, plasmid extracted by alkaline lysis method and screened by restriction digestion. Sequences were confirmed with the following primers: universal LNCX forward primer AGCTCGTTTAGTGAACCGTCAGATC, forward primers at different sites of RB plasmids GCTATGTGTCCTTGACTATT (starts at 685bp), CAACTGCACAGTGAATCC (at 1215bp), GTGATCGAAAGTTTTATCAAAGC (at 1628bp) and CCTCGAAGCCCTTACAAG (at 2416bp).
Homemade electrocompetent cells (AdEasier) were cultured by transformation of AdEasy-1 plasmid into BJ5133 strains. pAdEasy-1 (Addgene plasmid # 16400 ; http://n2t.net/addgene:16400 ; RRID:Addgene_16400) and BJ5133 strains (Addgene plasmid # 16398) were generous gift from Bert Vogelstein [37]. GOI containing (WT-RB or RBΔCDK) or empty (GFP control) shuttle vectors were linearized using PacI enzyme and electroporated into AdEasier cells (2500V, 2.5Ω and 25µF). Transformed cells were cultured, individual colonies were isolated and screened by PacI restriction digestion. Restriction mapping confirmed individual plasmids were transfected into HEK293 cells for 10–14 days. Viruses were released from the cells by 3 freeze thaw cycles and collected. Then, individual colonies of viruses were insolated using plaque purification method as described below.
HEK293 cells were seeded into a 6 well plate at 50–70% confluence per well. Next day, cells were infected with 1ml of culture media with appropriate dilution from the virus stock (1:1000 to 1:10,000). Six hours later, media was gently replaced with 3ml complete media containing 5% agarose (preheated at 44°C). The plate was allowed to solidify at RT in a biosafety cabinet and incubated at 37°C for 7–10 days. Individual plaques were isolated and used to infect 24 well plates and confirmed by western blot analysis.
Adenoviruses (confirmed clones) were propagated and purified by discontinuous CsCl gradient method. CsCl gradient was created by adding 6ml of 4.0M CsCl (67g CsCl in 100ml of 10mM HEPES) at the bottom layer, 9ml of 2.2M CsCl (38g CsCl in 100ml of 10mM HEPES) and 15ml of adenoviral supernatant at the top. Tubes (Beckman #344058) were ultracentrifuged at 34, 500 rpm in Type70 Ti rotor (Beckman ultracentrifuge). Virus band was obtained between 2.2M and 4M CsCl and collected by puncturing with a 18G needle. Collected viruses were dialyzed against 10% glycerol containing 1X PBS at 4°C overnight twice. Lastly, the virus stocks were dialyzed by 5% glycerol containing 1X PBS at 4°C for 4h. Virus titers were determined by infecting HEK293 cells by serially diluted virus stocks. GFP reporter expression was used to calculate the virus titer.
SLC7A11-GFP overexpression in HT1080 cells. Phoenix retroviral packaging cells were plated to be 90% confluency on the day of transduction into a 6 well plate. The cells were transfected with SLC7A11-GFP plasmid, a gift from Alec Kimmelman [30] or control Rv-GFP plasmid (2.5 µg) using lipofectamine 3000 (Life technologies) according to manufacturer’s instructions. After 16hrs, media was replaced. Generated retroviruses were collected 48hrs post transfection. HT1080 cells from 24 well plates were infected with 100 µl of 48hr-viruses separately along with polybrene (4µg/ml). Next day, cells were expanded into 10 cm plates separately. SLC7A11-GFP cells were grown in culture media containing neomycin (400µg/ml). Since control GFP cells had no antibiotic resistant genes, individual colonies were selected by GFP expression using a fluorescence microscope. Moreover, collected Rv-GFP clone was sub-cultured to isolate individual clones again. After 10–14 days, GFP or GFP- SLC7A11expressing colonies were selected, expanded, grown and confirmed by western blot analysis.
Western Blotting. Cells were harvested by scraping and lysed in a buffer solution containing: 50 mM Tris (pH 7.4), 150 mM NaCl, 0.5% NP-40, 1 mg/ml aprotinin, 2 mg/ml leupeptin, 1 mg/ml pepstatin A, 1 mM DTT, 0.1M phenylmethylsulfonyl fluoride (PMSF), 1 mM sodium fluoride and 1 mM sodium vanadate for 20 min on ice. Insoluble debris was removed by centrifugation at 16,000 g for 20 min at 4°C. Equal amounts of protein for each sample (determined using BCA protein assay kit - Pierce) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Gels were transferred to polyvinylidene difluoride membranes (Millipore), blocked in a solution containing 5% (w/v) non-fat dry milk dissolved in PBST [PBS containing 0.05% (v/v) Tween 20], and probed with antibodies as indicated. For phospho antibodies, membranes were blocked, or primary antibodies were diluted in 5% (w/v) bovine serum albumin in tween containing tris buffered saline.
Antibodies were generally diluted in blocking solution at 1:1000. Primary antibodies recognizing SLC7A11 (cell signaling technologies, CST#12691S), ATF4 (Abclonal #A0201), c-Myc (CST #9402S), FTL (Proteintech #10727-1-AP), RB (CST#9309S), HA (CST #3724S), cyclin-E (BD pharmingen #BD-51-1459GR), p21 (Santa Cruz #C-19/HRP), p53 (Santa Cruz #D0-1/HRP), E2F1 (Santa Cruz #56661), Nrf2 (Abclonal #A0674), p-Nrf2 (S40)(Abclonal #AP1133), GPX4 (Abclonal #A11243), GFP (Santa Cruz #9996/HRP), ALOX5 (Abclonal#A2877)), CDK2 (Santa Cruz #M2), ⍺-Tubulin (Sigma #T5168), GAPDH (Abclonal #AC002) and \({\beta }\)-Actin (Abcam #3280) were generally incubated at 4° C overnight. Signals were detected using horse-radish peroxidase conjugated secondary antibodies (Biorad) and enhanced chemiluminescence (Biorad). Western blot images were mostly taken by a chemi doc and the digital images were analyzed using ImageJ software.
Lipid ROS measurement. NARF2 pBpuro cells were seeded as 5 x 105 cells into a 9cm plate. Next day, the cells were treated with 20 µM CETZOLE-1 along with BODIPY 665/676-C11 dye (0.5 µM) (Thermofisher). 24 h post treatment, cells were collected by trypsinization, washed with 1x PBS and resuspended in 2% FBS containing 1x PBS. Cells were analyzed in PE channel using a BD LSR Fortessa FACScanner. 20, 000 events per condition was analyzed from 3 independent samples. The experiments were performed in duplicate (n = 6). Collected data were processed with FlowJo v10 software.
siRNA transfection. NARF2 and HT1080 cells were seeded in 6 well plates at a density of 2 x 105 and 3 x 105 respectively. Next day, the cells were transfected by 50 pmol of siRNAs against E2F1 or 50 pmol non-specific (scrambled/ siNeg) or Myc (10-50pmol) using Lipofectamine RNAi Max reagent according to the manufacturer’s instructions (Invitrogen life technologies). One day later, cells from multiple wells were expanded into 96 well plate for ferroptosis sensitivity assay or 6cm/ 9cm plates for western blot/ RNA extraction. siRNAs were obtained from Life technologies siE2F1 (cat#4427038), siMyc (cat#4427037) and siNeg (cat#4390843)
Cell cycle analysis by PI staining. NARF2 cells were seeded at 1 x 105 cells per 6cm plate. After one day, cells were transduced with GFP, WT-RB and RBΔCDK viruses at 50 and 200 MOIs. The Next day, media was replenished with fresh media. Three days post transduction, the cells were harvested by trypsinization, washed in 1X PBS and resuspended in 400µl of 1X PBS containing 2% FBS (PBSP). Then, cells were fixed with 700µl of pre-chilled 100% ethanol by adding drop wise (while vortexing) and kept at -20°C for 30 minutes. Cells were spun down and resuspended in 1ml of 2% PBSP. The cells were treated with RNase-A at 50µg/ml for 30min at 37°C. Cells were collected, stained with Propidium Iodide dye (10µg/ml) and analyzed by flow cytometry.
Transient c-Myc overexpression
NARF2 (2 x 105) or HT1080 (4 x 105) cells were plated into 6 well plates. The next day, cells were transfected with indicated amount of c-Myc plasmid (0.5–2.5µg) using Lipofectamine LTX Plus reagent (Life technologies). One day later, cells were expanded into 6cm or 7cm plate according to the experiment. 48h later post transfection, cells were harvested and analyzed by western blotting. As a transfection control, cells were transfected with a GFP reporter plasmid. We observed > 90% transfection efficiency by GFP positive cells.
Real time PCR (qRT-PCR)
Cellular RNA was extracted using TRIzol (Invitrogen Life technologies) method according to the manufacturer’s protocol. 1µg RNA was used to synthesize cDNA by reverse transcription reaction using oligo-dT primer according to NEB protocol (MuLV RT kit #BO2535). qPCR reactions were performed using iTaq Universal SYBR Green Supermix (Bio-Rad #1725121) and run it on Biorad CFX96 machine. Relative mRNA expression level was normalized to GAPDH and quantified using comparative CT method (ΔΔCT). n = 6, biological triplicates and technical duplicates. Primer sequences for the genes are shown in Table 1.
Table 1
Primer sequences for real time-PCR
Gene (Human) | Oligo nucleotide sequence |
ATF4 | Fw: AAACCTTACGATCCTCCTGGAG |
Rev: TGGCTGCTGTCTTGTTTTGC |
CCNE1 | Fw: ATGGCCAAAATCGACAGGAC |
Rev: AGGCTTGCACGTTGAGTTTG |
SLC7A11 | Fw: GGCAGTGACCTTTTCTGAGC |
Rev: TCATTGTCAAAGGGTGCAAA |
GPX4 | Fw: TGGTTAACCTGGACAAGTACCG |
Rev: AAACCACACTCAGCGTATCG |
C-MYC | Fw: CCTGGTGCTCCATGAGGAGAC |
Rev: CAGACTCTGACCTTTTGCCAGG |
GAPDH | Fw: GTCGGAGTCAACGGATTTGG |
Rev: TGGAATTTGCCATGGGTGGA |
ALOX5 | Fw: TCGATGCCAAATGCCACAAG |
Rev: TGAAGCGGTTGATGAACAGG |
E2F1 | Fw: CCATCCAGGAAAAGGTGTGAAA |
Rev: GGTGATGTCATAGATGCGCC |
E2F2 | Fw: ATGACATCACCAACGTGCTG |
Rev: CTGGTGGGGTCTTCAAACATTC |
E2F3 | Fw: AGGGCTCTCTTACACCGCACT |
Rev: AAATGCCACTCACACAATGGG |
E2F4 | Fw: GTCACAGAGGACGTGCAGAA |
Rev: GCCAAGAGGGTATCTCCAGC |
E2F5 | Fw: CCATTCAGGCACCTTCTGGTAC |
Rev: AGCAGCACATGGATAGGTCCTG |
E2F6 | Fw: GCGGAGAGTGTATGACATCACC |
Rev: GTCAGAAAGTTCCTCCTGTAGCT |
E2F7 | Fw: GACAGACAGCAAGCGGAACC |
Rev: GGGTCGGAATAGTCCCTTTTTCT |
E2F8 | Fw: GAGGCTCAAAGAGGGCAAGCAT |
Rev: ATGAGCACTGCGTGAGAGGGAT |
Determining MOI of adenovirus (non-GFP). HEK293 cells were plated in 10 cm plate and next day infected with second-generation recombinant adenoviruses. Generated viruses were collected 2–3 days later from both the supernatant and cells by freeze-thawing process three times (frozen in dry ice and thawed at 37°C). To determine viral titers, HEK293 cells were seeded in 96 well plates and next day, the virus suspension was diluted at 1:100. Later, 10µl virus supernatant was added to cells in 90µl culture media. One week later, cytopathic effect (CPE) was assessed by phase contrast microscopy. Alternatively, infected cells were fixed in 100% methanol at -20°C for 20 min. Cells were blocked by 1% PBSP. One hour later, cells were probed with FITC conjugated Hexon antibody at 1:5000 in blocking buffer for 1 h. Cells were washed 3X with PBSP and infected cells visualized by fluorescence microscopy using an EVOS microscope. Titers determined using CPE or hexon immunofluorescence were similar.
Statistical analysis
Statistical significance was determined (* p < .05) by Student's t test. Measurements of cell viability involved the preparation of triplicate samples, used to calculate averages and standard deviations. All cell viability studies were repeated in this manner at least once (total n ≥ 6). IC50 curves of SLC7A11-GFP clones were plotted using GraphPad Prism 9.0. Gene expression (mRNA) level was determined using comparative CT method (ΔΔCT). n = 6, biological triplicates and technical duplicates.