Cell culture and treatment
Human colorectal cancer cell lines HT29 and SW620 were purchased from the Shanghai Institute of Cell Biology at the Chinese Academy of Sciences, and maintained in McCoy’s 5A modified medium (Gibco, USA) and Leibovitz’s L-15 medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Australia) and 1% antibiotics (penicillin and streptomycin). Cells were cultured in a humidified incubator containing 5% CO2 atmosphere at 37°C. Homoharringtonine was obtained from Minsheng pharmaceutical Co. Ltd (Zhejiang, China). The cells were treated with different concentration of HHT injection (1.5µM, 3µM, 6µM) to detect the cell cytotoxicity. Lipofectamine 3000 transfection reagent (Invitrogen, USA) was used to transfect the SW620 cells with the PCM1 plasmid according to manufacturer’s protocols.
Cell viability and Colony formation assays
For the CCK8 assay, HT29 and SW620 cells (2×103 cells/well) were seeded into 96-well plates and incubated overnight at 37°C. The cells were treated with HHT at the indicated concentrations for another 24h, 48h, 72h. Then, 10µL CCK8 solution (KeyGEN BioTECH, China) was added to each well and further incubated for an additional 2h at 37°C according to the manufacturer’s instruction. The cell viability was assessed by measurement of the absorbance at 450 nm with a microplate reader. For the colony formation assay, SW620 cells transfected with NKD1 or PCM1 were seeded into six-well plates and cultured for 2 weeks. Then, the cells were washed with cold PBS before being fixed with 100% methanol and stained with 0.5% crystal violet solution for 10 min. The number of colones were counted using ImageJ software from representative areas. All experiments were performed in triplicate.
5‑Ethynyl-2’-deoxyuridine (EdU) staining assay
Cell proliferation ability and DNA synthesis were determined using the EdU staining assay. Briefly, HT29 and SW620 cells were treated with different concentrations of HHT for 48 h, and then cells in logarithmic growth phase were seeded on the cover slips (NEST, USA), and added with 10 uM EdU solution (Abcam, USA) to each well for incubation 2h at 37°C. Subsequently, the cells were fixed with 4% paraformaldehyde for 20 min and treated with 2M HCl for 30 min at room temperature. After washed with cold PBS buffer three times, each well was supplemented with penetrant with 0.5% Triton X-100 (Solarbio, China) and blocked with 10% goat serum (Solarbio, China) for 1h. The nucleus was visualized with DAPI reaction solution (Sigma, USA) for 20min in the dark and mounted with fluorescence quenching agent (Solarbio, China). EdU positive cells were finally photographed and counted under a fluorescence microscope (Olympus, Japan) with different field.
RNA extraction and quantitative real-time PCR (qRT–PCR)
Total RNA was extracted from tissues and cultured cells using Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA concentration was measured on Nanodrop Spectrophotometer (Thermo Fisher Scientific, USA) and reverse transcription kit (Takara, Japan) was utilized to perform cDNA reverse transcription. RT-PCR amplification was performed with specific primers and carried out using the SYBR-Green PCR system (Takara, Japan). GAPDH served as the internal control throughout the experiment. The relative mRNA expression levels were calculated using the 2–ΔΔCt method. The sequences of the primers used for qPCR were as follows: NKD1: F: ACCATTGCGTAGATGAGAACAT, R: CCAAATTGGGACGTGTAGTTTT. GAPDH: F: TGTTGCCATCAATGACCCCTT, R: CTCCACGACGTACTCAGCG.
RNA interference vectors and cell transfection
The lentivirus vector containing the small interfering RNAs (siRNAs) that specifically target NKD1 were designed and synthesized from Shanghai Genechem Co, Ltd (Shanghai, China). For lentiviral transduction, SW620 cells were seeded into 24-well plates to facilitate the cell confluence to 50%, and transfected with three siRNAs vector or negative control vector according to the manufacturer’s protocol. After culture in an incubator at 37°C for 8–12 h, the serum free medium was replaced with complete medium. Screening of stably transfected siRNA-NKD1 cells with 1 µg/ml puromycin reagent (Carlsbad, USA). Cell transfection efficiency was observed under fluorescence microscope and examined using qRT-PCR and Western blot assays. The NKD1 siRNA sequences were shown in Table 1.
Table 1
The target sequences of NKD1 siRNA
NO. | Target Sequences | Accession | GC% |
NKD1-RNAi (76831) | CGAGAGGAGAAACCACTACTT | NM_033119 | 42.11% |
NKD1-RNAi (76832) | GACCTTCACCCTGTATGACTT | NM_033119 | 47.62% |
NKD1-RNAi (76833) | CAGCAAGATGCTGCGGGTAAA | NM_033119 | 52.38% |
Cell cycle and apoptosis analysis by flow cytometry
For the cell cycle analysis, HT29 and SW620 cells were plated into a six-well plate and treated with indicated concentration of HHT for 48h. Cells were digested with trypsin withiout EDTA to prepare a single-cell suspension. After centrifugation, the supernatant was removed and the cells were resuspended in cold PBS buffer. Precooled 70% ethanol was added to fix the cells overnight at -20°C. Cells were resuspended in 200ul binging buffer and stained with PI staining solution for 30min at room temperature. Cell cycle distribution was measured and quantified by the flow cytometry System (BD Biosciences, USA). For the apoptosis assay, AnnexinV-APC/PI double staining apoptosis detection kit (MULTI SCIENCE, China) was employed to detect the apoptosis rate of the HT29 and SW620 cells. The binding buffer containing 10µL Annexin V-APC was added to the cells and incubated for 15 min at room temperature in dark conditions, and then added 5µL PI in dark conditions for 10min. The cell apoptosis rate was examined by flow cytometer and the data was analyzed with BD Cell-Quest and FlowJo software.
Protein extraction and Western blot analysis
In brief, the cells were collected and extracted using a whole protein extraction kit (KeyGEN BioTHCH, China) containing lysis buffer, Protease Inhibitor Cocktail and PMSF for 45 min on ice. Then the lysates were centrifuged at 13,000g at 4°C for 20 min and the total protein concentration was measured by BCA detection kit (Thermofisher Scientific, Inc). Equal amounts of proteins were electrophoresed on 10% SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% defatted milk for 1 h at room temperature and incubated with specific primary antibodies 4°C overnight. Subsequently, the membrane was further incubated with HRP-conjugated secondary antibodies against goat anti-rabbit or anti-mouse IgG (ab205718; 1:5000, Abcam) at room temperature for 1 h. The protein bands were visualized using BioImaging Systems (BIO-RAD, USA). Anti-GAPDH antibody was used as an internal control to normalize protein levels. Specific antibodies were shown in Table 2.
Table 2
The antibodies used in the western blotting analysis
Antibody | Company | Catalogue number | Antibody dilution |
GAPDH | Abcam | ab128915 | 1:5000 |
CDK2 | Abcam | ab32147 | 1:2000 |
CDK4 | Abcam | ab108357 | 1:1000 |
CDK6 | Abcam | ab151247 | 1:1000 |
CyclinD1 | Abcam | ab16663 | 1:500 |
CyclinE | Abcam | ab33911 | 1:1000 |
NKD1 | Abcam | ab133650 | 1:2000 |
Bax | Cell Signaling Technology | #2772 | 1:2000 |
Bcl-2 | Cell Signaling Technology | #2872 | 1:1000 |
Caspase-3 | Cell Signaling Technology | #9665 | 1:1000 |
Caspase-9 | Cell Signaling Technology | #9508 | 1:1000 |
PARP | Cell Signaling Technology | #9542 | 1:1000 |
Cleaved-PARP PCNA PCM1 DHFR | Cell Signaling Technology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology | #5625 sc-56 sc-398365 sc-377091 | 1:1000 1:500 1:500 1:500 |
Co-immunoprecipitation assay
The cells were harvested and lysed in cold lysis buffer. Equal amounts of cell lysates were incubated with normal IgG or special primal anti-NKD1 (CST) overnight at 4°C. Protein A/G-agarose (Abcam) were washed with cold PBS, and then incubated in antibody for 4h. After that, the immunoprecipitated complex was washed three times with ice-cold PBS and remove the supernatant. Then, adding 5x loading buffer into the precipitation to boil protein. The eluted proteins were separated by SDS-PAGE. Bound proteins were analyzed by western blotting with anti-PCM1 antibody (Santa cruz).
Immunofluorescence (IF) staining
HT29 and SW620 cells were seeded into 12-well plate on coverslips (NEST, USA) for 48 h. After washing with cold PBS, cells were fixed in 4% paraformaldehyde for 20 min. Subsequently, the coverslips were permeabilized with 0.5% Triton X-100 for 10 min and blocked with 5% normal goat serum for 1 h at room temperature. Then, incubated with primary antibodies against C-PARP (Abcam, 1:200, USA) overnight at 4˚C, and followed by incubation with fuorophore-conjugated secondary antibody (1:200, Invitrogen, USA) for 2 h. The nucleus was visualized with DAPI solution (Sigma, 1:500, USA) for 15 min in the dark. Finally, the slides were observed under a fluorescence microscope (Olympus, Japan), and integrated fuorescence density was measured by ImageJ software.
Immunohistochemistry (IHC) staining
The 10% formaldehyde fixed samples and tissue were embedded in paraffin and sliced into 5-µm thick sections. The microarray sections were deparaffinized by xylene and rehydrated through graded concentrations of alcohol solution, and then treated with 0.3% hydrogen peroxide for 30 min to inactivate endogenous peroxidase. After being repaired and blocked, the slides were incubated with primary antibodies at 4°C overnight, including anti-NKD1 (1:200, Abcam, USA), anti-Ki67 (1:200, Abcam, USA), anti-CDK4 (1:200, Abcam, USA), anti-Bax (1:100, CST, USA). Subsequently,
the corresponding HRP-labeled secondary goat anti-rabbit antibody was incubated at room temperature for 1h. After the diaminobenzidine (DAB) reaction was developed in dark conditions, the slides were counterstained with hematoxylin. The typical images were analyzed under microscope, and three equal-area non-repetitive fields were selected for each slice to calculate the number.
Tumor xenograft Model
BALB/C nude mice (6–8 weeks old) were purchased from the Beijing Vital River Laboratory Animal Technology Co. Ltd (Beijing, China). siNKD1 transfected cells were subcutaneously injected to establish the colorectal cancer xenograft model. Mice were randomly assigned into five groups (Control group, NC group, siNKD1 group, HHT group and siNKD1 + HHT group, n = 7). 0.5mg/kg HHT were intraperitoneally injected for 15 days to observe the inhibitory effect on tumor growth. The length and width of tumors were measured with electronic calipers and tumor volume was determined using the formula: volume= (Length × Width2)/2. Subsequently, the mice were euthanized and tumor tissues were isolated and frozen in liquid nitrogen or fixed in formalin to perform IHC assay. All animal experiments were performed in accordance with principles and guidelines approved by the Ethics Committee of Animal Research.
Statistical analysis
The statistical analysis was performed using SPSS 18.0, GraphPad Prism version 8.0 and Illustrator 2017 software. All assays were presented as the mean ± SD and the repeated individual experiments were performed for each group. Statistical differences among groups were determined by two-tailed Student t test or one-way analysis of variance (one-way ANOVA). Values were considered to be significant when P < 0.05.