1.1 Ethics, Consent, and Permissions.
This study was approved by the Ethics Committee of the Rasoul Akram Hospital (code: IR.IUMS.FMD.REC.1398.218). All methods were carried out by relevant guidelines and regulations. Signed consents were provided by all the patients for the use of human specimens for this experiment and none of the patients had previously undergone chemotherapy.
1.2 Tissue Samples
In this study, 50 patients (50 BC tissues and 50 adjacent normal tissues) were collected from patients who were under surgery in Rasoul Akram hospital from January 2019 to December 2021 by the ethical guidelines of the university research committee. All the specimens were examined by a pathologist and kept in the refrigerator at -80 C.
1.3 Culture And Transfection Of Cells
The Institute Pasteur of Iran supplied several BC cell lines (MCF-7, BT-474, MDA-MB-231, Eva-T, and MCF10A). Cell culture was carried out in Dulbecco's Modified Eagle medium (DMEM) from Gibco, Grand, USA, with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Sigma, USA) at 37°C in a standard environment containing 5% CO2. 3 105 cells were transferred to each well. Small interfering RNA (siRNA), miR-382-5p mimics, pcDNA, and controls were obtained from (Thermo Fisher Scientific, USA). Lipofectamine 2000 (Thermo Fisher Scientific, USA) was used according to the manufacturer's instructions for transfection.
1.4 Rna Isolation And Qrt-pcr
Trizol (Invitrogen, USA) was used to extract RNA from tissues and cells according to the manufacturer's instructions. Thermo Scientific RevertAid RT Kit was used for reverse transcription (Thermo Scientific, USA). The miScript Primer assay (hasmiR382-5p) and SYBR green master mix (Bio-Rad) were used to amplify the cDNA samples, and qPCR was performed on a 7500 Real-time PCR system (Applied biosystem, CA). Internally, U6 was used as a reference.2−ΔΔ Ct was used to test expression levels, which were quantified and repeated in triplicate. The following qPCR temperature cycles were carried out: 55°C for 3 minutes and 95°C for 12 minutes; 40 cycles at 95°C for 15 seconds and 65°C for 2 minutes. These were the primer sequences: (miR-382-5p) 5′-CTCGCTTCGGCAGCACA-3′ forward, 5′-AACGCTTCACGAATTTGCGT-3′ reverse (snoRNAU6) Forward: 5 CTCGCTTCGGCAGCACA3 and reverse: 5 AACGCTTCACGAATTTGCGT3 (PTEN) forward 5′-TCCCAGAGTTCATACCAGGA-3′ and reverse 5′-AATCTGCATGAAGGGAAC-3′.
1.5 Cell Invasion Assay
A transwell chamber from (Millipore, Burlington, MA, USA) was used for cell invasion assays. MCF-7 and BT-474 cell lines (3104) were cultured in serum-free DMEM in the upper chamber, while 10% serum-containing DMEM was used in the lower chamber. MCF-7 and B-474 cells (2104) were seeded on Matrigel-coated membrane inserts. After that, the chamber was placed on a cell culture plate and incubated for 24 hours at 37°C. Following that, the cells that passed through the migration pore membrane were fixed in 4% paraformaldehyde for 10 minutes, stained for 20 minutes with 0.1 percent crystal violet, and counted under a microscope.
Cell Viability Assay
The cell-counting kit-8 (CCK-8) was used to assess cell proliferation. Transfected MCF-7 and BT-474 cells were seeded in 96-well plates at 1 104 cells/well with miR-382-5p mimic, miR-NC, miR-382-5p inhibitor, and NC inhibitor and incubated for 24, 48, 72, and 96 hours. At each point, the media was discarded and replaced with fresh serum-free media containing a 10% final concentration of CCK-8 solution. The plates were incubated in the dark for two hours at 37°C and 5% CO2 atmosphere, and the absorbance was measured at 450 nm using a spectrophotometric plate reader.
1.6 Western Blot
1.6 Western blot
In our chosen cell lines and tissues, proteins were extracted with RIPA buffer, and concentrations were determined using the BCA kit. 10% SDS-PAGE was used for electrophoresis and PVDF membrane transfer (Bio-Rad, Hercules, CA, USA). The membrane was then blocked in 5% skim milk and incubated overnight at 4°C with the specific primary antibodies, including anti-PTEN (#9552) and anti-GAPDH (#2118) antibodies from Cell Signaling Inc. Membranes were incubated for 1 hour at room temperature with the secondary antibody (1:500) before being exposed in a darkroom with the ECL developer.
Antibody Reagents
Antibodies against PTEN (#9552), and anti-GAPDH antibodies (2118) were from Cell Signaling Inc.
1.7luciferase Reporter Gene Assay
PTEN 3 ′ UTR mRNA, either wild-type (WT) or mutant (MUT), was synthesized and inserted downstream of the pEZX-MT06 vector (Promega, Madison, WI). miR-382-5p mimics or scramble were transfected into HEK293T cells, respectively. The cells were harvested after 48 hours and the luciferase activity was measured using the Luc-PairTM Duo-luciferase assay kit.
1.8 Bioinformatic Analysis
Targetscan software (https://www.targetscan.org) was used to identify all genes with the ability to target miR-382-5p and next we display a graphical representation of the miR‐382-5p network by cystoscope software V3.7.2. star Base https://starbase.sysu.edu.cn/index.php tools were used to analyze the potential miRNA interactions with other noncoding RNAs and their role in cancers and the prognosis of the patient.
1.9 Statistical Analysis
The data were analyzed using the GraphPad Prism 7.0 software and expressed as mean standard deviation. All experiments were repeated at least three times. A t-test (two groups) and a one-way ANOVA were used to examine the differences (multiple groups). Spearman correlation analysis was used to investigate the relationship between miR-382-5p and PTEN expression. (A P0.05 indicates a statistically significant difference).