2.1 Ethics statement
This study and all the experimental procedures were approved by the Science Research Department (in charge of animal welfare issues) of the Institute of Animal Sciences of Chinese Academy of Agricultural Sciences (IAS-CAAS) (Beijing, China). Ethical approval was also provided by the animal ethics committee of IAS-CAAS (No. IAS2021-25).
2.2 Animal and sample preparation
In this study, the blood samples were collected from 365 Yunshang black goats with the first three kidding numbers records from Honghe Hani and Yi Autonomous Prefecture, Yunnan Province, China. All goat were raised in the same environment and conditions. Five high-fertility (mean kidding number = 3.4 ± 0.42) and five low-fertility (mean kidding number = 1.8 ± 0.27) goats were selected and ovarian tissues were collected and placed in liquid nitrogen, and then stored at -80 ℃.
2.3 Goat granulosa cells collection
Fresh ovarian tissues of goats were obtained from the slaughterhouse and placed in saline (containing 2% double antibody (Penicilin-Streptomycin, Gibco, USA)) at 37 ℃. It was washed 3 times with 75% medical alcohol and 3 times with 37 ℃ pre-warmed saline (containing 2% double antibodies). We used a 5 mL medical syringe to extract ovarian follicles with follicle diameters of 2–6 mm and collected them into 15 mL centrifuge tubes (Axygen, USA). The supernatant was removed by centrifugation at 2000 r/min for 5min using a low-speed centrifuge, resuspended by adding DMEM/F12 medium (Gibco, USA) (containing 2% double antibodies), centrifuged at 1500 r/min for 5 min, supernatant removed, and repeated 2 times. We added the obtained cell sediment to 10 mL of DMEM/F12 complete medium and cultured the cells in inoculated 5 cm2 culture dishes (37 ℃, 5% CO2, saturated humidity). The pellet cell density reached 85% or more and was placed in 10 cm2 culture dishes and incubated under the same conditions.
2.4 DNA and RNA extraction, and cDNA synthesis
Goat genomic DNA was extracted using the Animal Whole Blood DNA Extraction Kit (Tiangen, China) according to the manufacturer’s protocol. The quality and concentration of DNA samples were detected by Nano Drop 2000 (Thermo Fisher, USA) and 1.2% agarose gels.
Total RNA was extracted from ovarian tissue and goat GCs using the Tiangen Animal Tissue RNA Extraction Kit (Tiangen, China) and the Tiangen Animal Cell/Tissue RNA Extraction Kit (Tiangen, China) according to the manufacturer’s protocol, respectively. The quality and concentration of total RNA were examined by Nano Drop 2000 and 1.2% agarose gels. The cDNA was synthesized using by TaKaRa Reverse Transcription Kit (TaKaRa, Japan).
2.5 Real-time quantitative PCR (RT-qPCR)
The RT-qPCR primers were designed by PrimerPrimer5 software according to the gene sequences provided by NCBI (Table 1). The reaction system for RT-qPCR was 20 µL in total: 0.4 µL each of forward and reverse primers (10 µmol/µL), 10 µL SYBR Green Mix buffer, 2.0 µL cDNA (50 ng/µL), and the rest was made up with ddH2O. The reaction conditions: pre-denaturation at 95 ℃ for 5 s, denaturation at 95 ℃ for 5 s, and 60 ℃ for 30 s, for a total of 40 cycles. Each RNA sample was performed in triplicate. The relative levels of mRNAs were calculated using the 2−ΔΔCt method. The RPL19 was the reference gene for normalization.
Table 1
RT-qPCR primers information
Gene Name | Sequence (5’-3’) | Length (bp) | Temperature (℃) | GenBank |
PRDM15 | F: TCCATGACAACATCCGGGAAT | 186 | 58 | XM_018051675.1 |
R: GCTTGTGCGTCTCCATTGTGT |
AKT2 | F: GCCTGCCCTTCTACAACCA | 199 | 59 | XM_018065816.1 |
R: ACGATGCTGGCGAAGAATC |
PPP2R5C | F: TCAAGCGAGCACCATCAGCATC | 201 | 58 | XM_018066070.1 |
R: GCGAGCCTCTTCGTTCACTGTC |
Cyclin-2 | F: ATGTGGATTGCCTCAAAGCC | 162 | 59 | XM_005680985.3 |
R: CAGGTCGATATCCCGAACATC |
CDK4 | F: GAGCATCCCAATGTTGTCAGG | 140 | 59 | XM_005680266.3 |
R: ACTGGCGCATCAGATCCTTT |
RPL19 | F: ATCGCCAATGCCAACTC | 154 | 60 | XM_005693740.3 |
R: CCTTTCGCTTACCTATACC |
2.6 Single nucleotide polymorphisms (SNPs) and genotyping detection of PPP2R5C
Primers for the PPP2R5C promoter region were designed according to the sequence provided by the Ensembl database (Table 2). The PCR products were sequenced by Shanghai Biotechnology Service Co., Ltd., and the sequencing results were analyzed by SeqMan software. Primers for the PPP2R5C g.65977460A > G locus were designed and sequenced using KASP genotyping technology (Composites Biotechnology Co., Ltd., Tianjin, China) (Table 3). The samples used for genotyping were previously extracted genomic DNA from 365 Yunshang black goats, diluted to a concentration of 40–80 ng/µL.
Table 2
Primers information for PCR sequencing
Primers Name | Sequence (5’-3’) | Length (bp) | Temperature (℃) |
PPP2R5C-1 | F: CCCAGGATACTCTGATTCAGAAATGATGT | 1024 | 59 |
R: CTAGACTTCAGCGGGAAAGGCA |
PPP2R5C-2 | F: TTGCCTTTCCCGCTGAAGTCT | 173 | 59 |
R: CCATTTATTAACTAACCACAGAAGGTTCCGT |
PPP2R5C-3 | F: GAGTTAAGAAACATAGAAACTTTGTCATATGAAG | 629 | 59 |
R: TTCCCTCACTGTGGTCTAGGG |
PPP2R5C-4 | F: AAAAAACAACAGCGAGATACGT | 259 | 59 |
R: ACTGAGGTCCAAGCAGAG |
PPP2R5C-5 | F: GGGAGGTGGGGGGCATG | 420 | 59 |
R: CCGTTCTTTCAGAGTAAAAGGCAACG |
PPP2R5C-6 | F: CACCACCTCATCTGTGGCT | 360 | 59 |
R: TTCAGATTACCCGAAGGGCAAGAAC |
Table 3
Primers information for SNPs genotyping
Gene Name | Primer (5’-3’) | Primer_AlleleFAM (5’-3’) | Primer_AlleleHEX (5’-3’) |
PPP2R5C g. 65977460A > G | TCATGTCTAGAA TCATGTCTAGAA | gaaggtgaccaagttcatgctAACGTATAAAGCGAGAAGACATGG | gaaggtcggagtcaacggattAACGTATAAAGCGAGAAGACATGA |
2.7 Plasmids construction, extraction, and transfection
The overexpression plasmids pcDNA3.1-PPP2R5C, pcDNA3.1-PPP2R5C NC, pcDNA3.1-PRDM15 and pcDNA3.1-PRDM15 NC were constructed using the pcDNA3.1 vector based on the sequence of the coding region of goat PPP2R5C and PRDM15 provided by NCBI database (Biotechnology Co., Ltd., Shanghai, China). The interference plasmids si-PPP2R5C, si-PPP2R5C NC si-PRDM15 and si-PRDM15 NC were designed and synthesized through Jin Wei Zhi Biotechnology Co., Ltd., (Suzhou, China).
Goat follicular granulosa cells were seeded in 6-well plates at a density of 1×106 cells/well, and three replicates were set up for each experimental group. Added 230 µL of Opti-MEM to each well and mix with 20 µL of plasmid at a concentration of 200 nmol/L by blowing. Liposomes consisting of 244 µL Opti-MEM and 6 µL Lipofectamine® 2000 were added to form the transfection complex and incubated for 20 min at room temperature. Meanwhile, 1.5 mL Opti-MEM was added to each well of granulosa cells and incubate at 37 ℃ with 5% CO2 at saturated humidity, and replaced with complete medium after 6 h of transfection. Cells and supernatant were collected 48 h after transfection.
2.8 Western Blotting
Total protein was extracted from ovarian tissues and granulosa cells using the Whole Protein Extraction Kit (Solarbio, China). Lysate containing protease inhibitor was added according to the manufacturer’s protocol, homogenized, lysed for 30 min, shaken every 15 min, centrifuged at 12 000 rpm for 30 min at 4 ℃, and the supernatant was collected. The protein concentration curve was determined according to the instructions of the BCA Protein concentration assay kit (Solarbio, China). Added 5×SDS loading Buffer at 1:4, mixed well and incubated in a metal water bath for 10 min at 100 ℃, and stored the denatured protein at -80 ℃. The 30 µg of denatured protein was electrophoresed on a 10% SDS-PAGE gel for 30 min at 80 V and then 45 min at 120 V. After electrophoresis, the membranes were transferred with PVDF membrane at 150 mA for 60 min, blocked with blocking solution for 3 h at 4 ℃. Subsequently, the anti-PPP2R5C, anti-P13K-Akt, anti-GAPDH, anti-Cyclin-D2 and anti-CDK4 (diluted at 1:1,000) were incubated overnight at 4 ℃. The membrane was washed 5 times with TBST for 5 min each time. The anti-HRP (1:1,000) was used to incubation for 1 h at room temperature, developed with extra hypersensitive ECL chemiluminescent reagent, exposed to Odyssey CLX imaging system (Li-COR), photographed, and saved. The ratio of the target protein to the gray value of GAPDH was used to express the relative expression level of the target protein.
2.9 Plasmid construction and dual luciferase activity assay
To evaluate the promoter activity of PPP2R5C with different mutation genotypes, plasmids of PPP2R5C wild type (PPP2R5C-Wild-C) and mutant type (PPP2R5C-Mutant-T) were constructed, respectively. A sequence of +/-100 bp before and after the mutation site was inserted into the pGL3-basic vector, and the promoter activity of the fragment was verified by cell transfection. Transfection was performed using Lipofectamine 2000 (Thermo Fisher, USA) when the density of HEK293T cell lines in 24-well plates reached to approximately 70%. The Opti-DMEM (Thermo Fisher, USA) was replaced with complete medium 6 h after transfection, and cells were collected 48 h later and transferred to 96-well plates for dual luciferase activity assay. The activity of Firefly and Renilla was measured using a dual luciferase assay kit (Promega, China) and a Modulus single-tube multimode reader (Turner Biosystems, Sunnyvale, CA, USA) according to the manufacturer’s protocol.
2.10 Bioinformatics analysis
The JASPAR (http://jaspar.genereg.net) online software was used to predict the transcription factors that might bind to the PPP2R5C g.659777460A > G mutation (Stormo 2013) (Wasserman & Sandelin 2004). The STRING (https://cn.string-db.org/cgi/input?sessionId=bj9k5LRfbsMR&input_page_show_search=on) online software was used to predict the proteins that might interact with PPP2R5C (Szklarczyk et al. 2021).
2.11 Chromatin immunoprecipitation real-time quantitative PCR (ChIP-qPCR)
Adherent cells were cultured in 10 cm2 dishes containing 10 mL of growth medium and grown to 80%-90% density. The crosslinking was fixed with 1% formaldehyde for 10 min and terminated with 10×glycine according to the manufacturer’s protocol (Abmart, Shanghai, China). Cells were lysed in cell lysis buffer containing a protease inhibitor mixture at 4 ℃, and the treated cells were collected at 1000 rpm/min. Cell lysates were collected after sonication, and treated with 1.2% agarose to determine the effect of fragmentation. Cell lysates were incubated overnight at 4 ℃ on a spinner with the appropriate antibodies (antibody concentration: 1:1000). The A/G magnetic beads were added to the reaction and incubated on a rotator at 4 ℃ for 4 h. DNA purification was performed using purification columns, followed by identification and analysis using real-time quantitative PCR.
2.12 5-ethynyl-2' -deoxyuridine (EdU)
The proliferation of goat granulosa cells was measured using the EdU-488 Cell Proliferation Assay Kit (Beyotime, China) according to the manufacturer’s protocol. After cell treatment, the EdU reagent at a final concentration of 10 M was added to each well of a 6-well plate and incubation was continued for 6 h in a cell culture incubator. The cells were then washed three times with PBS (Thermo Fisher, USA) and fixed with fixative for 15 min at room temperature, the fixative was removed and the cells were rinsed three times with washing solution. Subsequently, 1 mL of PBS containing 0.3% Triton X-100 was added and incubated for 15 min at room temperature. Finally, the prepared Click reaction solution (500: l) was added to each well and the cells were incubated in the dark at room temperature for 30 min to observe and quantify the number of cells stained with EdU.
2.13 CCK-8 analysis
The proliferation of goat granulosa cells was detected using the Cell Counting Kit-8 (CCK-8), according to the manufacturer’s protocol (Beyotime, China). Seeding the GCs into 96-well plates with approximately 100 µL of cell suspension per well. The 10 µL of CCK-8 solution into cells at 0, 6, 12, 24, 48 and 72 h. The plates were incubated in an incubator for 1–4 h to achieve a cell density of 90% or higher. The absorbance at 450 nm was measured using an enzyme marker and statistically analyzed.
2.14 ELISA
The ELISA was used to detect the levels of E2 and PROG in GCs with different treatment according to the protocol of E2 ELISA Kit and PROG ELISA Kit (Enzyme-linked Biotechnology Co., Ltd., Shanghai, China). The goat GCs culture supernatant transfected the pcDNA3.1-PRDM15, pcDNA3.1-PRDM15 NC, si-PRDM15 and si-PRDM15 NC were centrifuged at 2000 ×g for 5 min at room temperature. Then, 10 µL of the sample supernatant was collected and added to the bottom of the plate wells along with 40 µL of sample diluents and 100 µL of enzyme labeling reagents. After sealing the plates with sealing film, they were incubated at 37 ℃ for 60 min. Finally, we followed standard procedures of washing, color development and termination of the plates. The absorbance at 450 nm was determined by using a Fluorescence/Multi-Detection Microplate Reader (Bio Rad, USA).
2.15 Statistical Analysis
The observed genotypes, allele frequencies, Hardy-Weinberg equilibrium (HWE) and population indices (polymorphism information content, PIC; homozygosity, He; effective number of alleles, Ne) were calculated using PopGenev 1.31.
The association between SNP and kidding number was analyzed using a general linear equation formulation:
yij = µ + HYSi + Gj + eij
Where yij is the observed value of the litter size trait, µ is the population mean, HYSi is the herd-season fixed effect, Gj is the genotype fixed effect and eij is the random error.
Records of the number of kids produced in the first three litters were used in this study. One-way ANOVA was used to test the hypothesis that several means are equal.
The means of the three replicates were evaluated by statistical analysis of the collected data using SPSS 21.0 statistical software and are shown as mean ± standard error (SE). Student’s t-test was used to test for significant differences in the data between groups. *P < 0.05 and **P < 0.01 were considered as significant differences.