Ethical statement and study object
The usage of cerebrospinal fluid and tumor tissues was approved by the Institutional review board (IRB) of the Jilin University. The study protocol was authorized by the IRB of the Jilin University. with patient's written informed consent obtained. This study was performed in compliance with the Declaration of Helsinki. The animal experiments were approved by the Animal Ethics Committee of the Jilin University.
Glioblastoma tissue samples used in this study were collected from glioblastoma patients (n = 50) who underwent surgical treatment in the oncological neurosurgery department of the First Hospital of Jilin University from June 2016 to June 2019. Sample controls were obtained from non-glioblastoma patients (n = 20) with encephalopathy.
Cell culture and transfection
Human glioblastoma cell line U87MG, human monocyte cell line U937 and murine glioblastoma cell line GL261 were provided by the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. U87MG cells were cultured in Dulbecco’s modified eagle medium (DMEM; Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum (FBS). Meanwhile, U937 cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Thermo Fisher Scientific) with 10% FBS, which were further incubated with 100 ng/mL phorbol-myristate-acetate (PMA) (Sigma-Aldrich, St. Louis, MO, USA) for 24 h in vitro to induce the differentiation into macrophages. Additionally, 1 µg/mL EV was added to the medium of recipient cells for co-culture with EVs. All cell lines were identified by short tandem repeat (STR) and confirmed to be mycoplasma negative before the experiments. Small interfering RNA (siRNA), miRNA inhibitor/mimic and virus vectors were purchased from GenePharma (Shanghai, China).
Isolation of EVs
Cells were cultured in 10% EV-FBS-free DMEM (A2720801, GIBCO BRL, Green Island, NY, USA) under normoxia (21% O2) or hypoxia (1% O2). After 48–72 h of incubation, the culture medium was collected and the EVs were separated by ultracentrifugation. The EVs were isolated following the detailed procedures as previously described [7]. Human glioblastoma-EVs or murine glioblastoma-EVs were isolated using the Exoquick ULTRA EV Isolation Kit (EQULTRA-20A-1, System Biosciences, Irvine, CA, USA).
Transmission electron microscope (TEM)
The EV obtained by high-speed centrifugation of 400 mL medium was fixed in 2% glutaraldehyde overnight at 4℃, washed with PBS, fixed with 1% OsO4 for 1 h, dehydrated in ethanol and embedded with epoxy resin. Embedded-sections were added with saturated sodium periodate and 0.1 N hydrochloric acid, the size and morphological characteristics of which were observed using TEM (JEM-1010; JEOL, Tokyo, Japan) after 10 min.
Mixed with 4% paraformaldehyde, EVs were placed on the Formvar carbon coated Electron Microscopy (EM) grid, followed by the acquisition of Images using TEM (Hitachi, Tokyo, Japan). The EV surface marker proteins rabbit anti-CD63 (ab134045, 1:1000, Abcam, Cambeidge, UK), rabbit anti-Tsg101 (ab125011, 1:1000, Abcam, UK) and rabbit anti-Calnexin (ab92573, 1:20000, Abcam, UK) were determined using Western blotting while the particle size and concentration of EVs were analyzed using QNano (Izon Sciences Ltd, NZ).
Nano-particle tracking analysis
The size distribution and concentration of EVs were determined following the instructions of NTA (Zetasizer Nano ZS90 instrument, Malvern, UK), which associated with light scattering and Brownian motion. PBS-diluted EVs were injected into Zetasizer Nano ZS90 instrument, followed by the measurement of particle size according to Brownian motion and diffusion coefficient. The filtered PBS was used as a control. All samples were measured using NP100 film with 44.5 mm and 0.64 V voltage parameters. Samples were calibrated by the dilution of CPC100 standard particles at 1,000 times under the same condition. With 5 videos (60-s-duration) taken, data were analyzed using Zetasizer software (Malvern) to identify and track each particle.
EV labeling and immunofluorescence
EVs with the concentration of 0.1–0.2 µg were resuspended in 400 µL PBS and stained with CellMask Deep Red (Thermo Fisher Scientific) at excitation/emission wavelengths of 649/666 nm. During the labeling, EVs were incubated with deep red staining solution (1:1000) for 20 min at 37℃. Then EVs were centrifuged at 100,000 g for 1 h and diluted in PBS, followed by the determination of protein concentration using bicinchoninic acid (BCA) protein detection kit.
Cells were stained with CellTrace™ Carboxyfluorescein succinimidyl ester (CFSE, Life Technologies, Carlsbad, CA, USA) with a maximum excitation/emission wavelength of 492/517 nm. The immunofluorescence staining was performed after the covalent binding of cells diffused by lactone-digested CFSE with intracellular amines. Glioblastoma cells (3–5 × 105) in serum-free medium were stained with CFSE (working concentration of 5 µM) at a dilution of 1:1000 and incubated at 37℃ for 20 min in the dark. After cells were seeded into 8-well slides (Millipore, Billerica, MA, USA), EVs were incubated with CFSE-stained cells at different time points. Cells were fixed with 3.7% (w/v) formaldehyde for 5 min at room temperature, imaged and observed under a fluorescence microscope.
Chromatin immunoprecipitation (ChIP)
Cells were treated using the EpiQuik Tissue ChIP Kit (48 reactions) (P-2003-2, Epigentek, USA). Confluent cells at 70–80% confluency were fixed with 1% formaldehyde at room temperature for 10 min to generate the intracellular DNA-protein crosslink, which was then randomly broken by ultra-sonication into fragments. Cell fragments were centrifuged at 13,000 g at 4℃, followed by the division of supernatant into three tubes, respectively, which was separately added with antibody RNA polymerase II (positive control), mouse antibody immunoglobulin G (IgG) (1 mg/mL) or rabbit IgG (3900, Cell Signaling Technology, USA) (negative control) or antibodies against KDM3A (ab91252, Abcam, Cambridge, UK), H3K27me3 (ab1220, Abcam, UK), CTGF (SimpleChIP Human CTGF Promoter Primers #14927, USA), H3K27ac (ab4729, Abcam) and H3K4me1 (ab8895, Abcam). After immunoprecipitation, de-crosslink was performed and proteins were treated by proteinase K. DNA was eluted and purified using Active Motif's ChIP DNA purification kit (58002, Millipore). Each experiment was repeated 3 times.
Western blotting
Proteins were extracted from tissues or cells while cells were detached in RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China). Total protein concentration was quantified using BCA method, followed by the separation of proteins using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Separated proteins were transferred onto a polyvinylidene fluoride membrane (Millipore), which was blocked by 5% milk powder containing 0.1% Tween-20. Membrane was incubated with primary antibodies including rabbit anti-EZH1 (ab64850, 1:1000, Abcam), mouse anti-KDM3A (ab91252, 1:1000, Abcam), rabbit anti-CTGF (ab6992, 1:1000, Abcam), rabbit anti-iNOS (ab3523, 1:500, Abcam), rabbit anti-Arg-1 (93668, 1:1000, Cell signaling technology) and rabbit anti-β-actin (ab179467, 1:5000, Abcam) overnight at 4℃. Subsequently, membrane was further incubated with horseradish peroxide (HRP) labeled secondary antibody goat anti-rabbit IgG (ab205718, 1:5000, Abcam) or goat anti-mouse IgG (ab205719, 1:5000, Abcam) at room temperature for 2 h. Protein bands were developed with enhanced chemiluminescence reagent (BB-3501, Amesham, UK), and image analysis was performed in an imaging system (Bio-Rad, Hercules, CA, USA) with β-actin functioned as an internal reference. Each experiment was repeated 3 times.
RNA isolation and quantification
According to the instructions of the Trizol reagent (Invitrogen, Carlsbad, CA, USA), RNA was extracted, which was reversely transcribed into complementary DNA (cDNA) using the first strand cDNA synthesis kit (Tiangen Biotech, Beijing, China) or Primer script™ one-step RT-PCR Kit (Takara, Shiga, Japan). Real-time polymerase chain reaction was conducted in ABI 7500 real-time PCR system (Applied Biosystems, Carlsbad, CA, USA) using SYBR Green IReal-time PCR kit (Cowin Bioscience, Beijng, China) with GAPDH or U6 used as an internal reference. Cel-miR-39 (No. miRB00000010-3-1 and MQPS0000071-1-100, Riobio, Guangzhou, China) was used as an external reference for the detection of EV miR-27a-3p. The relative expression of genes was analyzed by 2-ΔΔCT method, and primers involved in this experiment were shown in Table 1.
Table 1
Primer sequences for RT-qPCR
| Human | Mouse |
miR-27a-3p | F 5-'GCGCGTTCACAGTGGCTAAG − 3' | |
R 5-'AGTGCAGGGTCCGAGGTATT − 3' | |
U6 | F 5-'AGAGAAGATTAGCATGGCCCCTG − 3' | |
R 5-'AGTGCAGGGTCCGAGGTATT − 3' | |
EZH1 | F 5-'CGAGTCTTCCACGGCACCTA − 3' | F 5-'CTCAGTGGCAACATGCCTAA − 3' |
R 5-'GCAAACTGAAAGACCTGCTTGC − 3' | R 5-'CCCACAAACACAACCAACAG − 3' |
KDM3A | F 5-'TTCTTTTCCTCCAAGATTCCC − 3' | F 5-'CCAGGAGAAGACTTCAGAGACATG − 3' |
R 5-'GGGACCATTCGAGCTGTTT − 3' | R 5-'GGTGTACTCAGGCAGTGGAATG − 3' |
CTGF | F 5-'TCAACCTCAGACACTGGTTTCG − 3' | F 5-'AGCCAACTGCCTGGTCCAGA − 3' |
R 5-'TAGAGCAGGTCTGTCTGCAAGC − 3' | R 5-'CGCAGAACTTAGCCCTGTATGT − 3' |
IL-10 | F 5-'GCTCCTAGAGCTGCGGACT − 3' | F 5-'TGGACAACATACTGCTAACCGAC − 3' |
R 5-'TGTTGTCCAGCTGGTCCTTT − 3' | R 5-'CCTGGGGCATCACTTCTACC − 3' |
TNFα | F 5-'GCCTGCTGCACTTTGGAGTG − 3' | F 5-'AAGCCTGTAGCCCACGTCGTA − 3' |
R 5-'TCGGGGTTCGAGAAGATGAT − 3' | R 5-'GGCACCACTAGTTGGTTGTCTTTG − 3' |
β-actin | F5-'ATCGTGCGTGACATTAAGGAGAAG − 3' | F 5-'AGATCAAGATCATTGCTCCTCCT − 3' |
R 5-'AGGAAGGAAGGCTGGAAGAGTG − 3' | R 5-'AGATCAAGATCATTGCTCCTCCT − 3' |
Notes: F, Forward; R, Reverse; EZH1, enhancer of zeste 1; KDM3A, lysine demethylase 3A; CTGF, connective tissue growth factor; RT-qPCR, reverse transcription quantitative polymerase chain reaction |
Cell counting kit-8 (CCK-8) assay
The proliferative capacity of glioblastoma cells was detected using CCK-8 kit (Dojindo, Kumamoto, Japan) according to the instructions. Glioblastoma cells were seeded in 96-well plates for co-culture with different EVs at 0, 24, 48 and 72 h. CCK-8 solution was added to each well, which was incubated for 2 h. Then, the viable cells were measured at the optimal density (OD) of 450 nm using a microplate (Multiskan Sky Microplate Spectrophoto-meter, Cat. No. 51119570, Thermo Fisher Scientific). Each experiment was repeated 3 times.
Transwell assay
The migration and invasion ability of glioblastoma cells was evaluated using Transwell assay by following the manufacturer’s protocol. Matrigel (BD Bioscience, Franklin Lakes, NJ, USA) coated apical Transwell chambers were placed at 37℃ for 30 min to polymerize Matrigel. Cells were cultured in serum-free medium for 12 h, harvested and resuspended in serum-free medium (1 × 105/mL). While 100 µL cell suspension was incubated in the basolateral chamber containing 10% FBS at 37℃ for 24 h. Cells that did not invade the surface of Matrigel membrane were gently removed with cotton swabs. Cells were fixed with 100% methanol and stained with 1% toluidine blue (Sigma-Aldrich). Stained cells were counted in five randomly selected areas under inverted light microscope (Carl Zeiss, German). Each experiment was repeated 3 times.
Dual-luciferase reporter gene assay
EZH1 3'-untranslated region (UTR) sequences containing binding sites with mutant type(MUT) or wild type (WT) miR-27a-3p were constructed by Genscript (Nanjing, China). Both EZH1 3'-UTR MUT and WT were cloned into pGL-3 luciferase reporter plasmids. HEK293T cells were cultured in 24-well plates for 24 h, which were then co-transfected with pGL-3-WT-EZH1 or pGL-3-MUT-EZH1 3'-UTR reporter plasmids, internal reference plasmids and miR-27a-3p mimic or mimic NC using Lipofectamine 3000 (Invitrogen, USA). Renilla luciferase activity and Firefly luciferase activity were measured by dual luciferase assay system (Promega, Madison, WI, USA) with Renilla luciferase as internal reference. The experiment was repeated 3 times.
Animal experiment
BALB/c female nude mice (n = 60) were purchased from SLAC Laboratory Animal (Shanghai, China). After 1-week adaptive feeding, mice were anesthetized with pentobarbital sodium and treated differently with 12 mice in each treatment. Sham-operated mice were taken as the sham group, while others were injected through the brain with murine glioblastoma cell line GL261 (with 106 cells each mouse) or macrophage (with 2 × 105 cells each mouse) with adenovirus-mediated CTGF knockdown. Subsequently, mice in each group were intravenously injected with PBS or the equivalent volume of EV (8 mg/kg) extracted from miR-27a-3p mimic-treated GL261 cells via the caudal vein every 3 days. Six mice were randomly selected from each group to record the survival time. The tumors of other mice were dissected 40 days after xenograft, frozen in liquid nitrogen or fixed in formalin, with serum samples collected.
Enzyme-linked immunosorbent assay (ELISA)
ELISA kits involving hsa-interlukin (IL)-10 (ab46034, Abcam), mmu-IL-10 (ab46103, Abcam), hsa-TNF-α (ab100654, Abcam) and mmu-TNF-α (ab208348, Abcam) were commercially obtained to detect the levels of IL-10 and TNF-α in the supernatant of U87-MG cells and peripheral blood of mice. Each well of the 96-well microtitration plates was added with 100 µL IL-10 or TNF-α (0.4 µg/mL) buffer solution and 50 mM sodium carbonate to adjust the pH value to 9.6. After overnight incubation at 4℃, the plate was blocked by PBS containing 1% BSA for 1 h at room temperature. IL-10 or TNF-a antibodies or samples to be tested were added to the wells, which were then incubated at room temperature for 2 h. Plates were incubated with 0.2 µg/mL biotinylated IL-10 or TNF-α antibodies for 2 h at room temperature. Diluted peroxidase-labeled antibiotic protein (1:1000; Sigma-Aldrich) was incubated with the plate for 1 h at room temperature. The chromogenic reaction was induced by the addition of 3,3',5,5'-tetramethylbenzidine (TMB)/H2O2 substrate solution, which was terminated by 1 M phosphoric acid after 30 min. The OD was measured at 450 nm wavelength using an automatic microplate reader. The OD value was measured with normalization to diluted antibodies in the medium, ranging from 10 to 2,000 pg/mL with standard curves plotted.
Hematoxylin-Eosin (HE) staining
Mouse brain tissues were fixed in 10% formalin for 24 h, routinely dehydrated and paraffin-embedded. Brain tissue samples were cut into 3 µm-thick sections and HE staining was performed following previously described methods [14] to determine the lesion areas in mouse brain tissues. The images were photographed under a microscope at 100-fold magnification.
Statistical analysis
All data were analyzed using SPSS 21.0 software (SPSS, Inc, Armonk, NY, USA). Measurement data were expressed by mean ± standard deviation. Unpaired t-test was used for comparison between two groups, while one-way analysis of variance (ANOVA) was used for comparison among multiple groups and Tukey's post hoc test. Comparison among groups at different time points was conducted using two-way ANOVA and Bonferroni’s post hoc test. A p < 0.05 was considered statistically significant.