4.1 Mouse Embryo Collection and Culture
The studies were conducted under the approval of the ethical committee of Sir Run Run Shaw Hospital Medical Ethics Committee. Superovulated eight-week-old ICR female mice were cocaged individually with ICR males after the hCG injection to obtain embryos. The presence of a vaginal plug the next morning was used to define E0.5. Immediately thereafter, the female mice were sacrificed through cervical dislocation. Fertilized zygotes were collected from oviducts and cultured in KSOM (M1450; Easycheck, Nanjing China) at 37°C in a 5% CO2 atmosphere. Then, embryos at different stages were harvested for immunofluorescence. An adhesion assay was conducted with blastocysts collected from the uteri of female mice on pregnancy day 3.5. Only expanded blastocysts appearing morphologically normal were included in the study.
4.2 Mouse Embryo Adhesion and In Vivo Implantation Assay
A mouse embryo adhesion assay and in vivo implantation were performed as described previously[39]. Briefly, mouse blastocysts were obtained at E3.5, and then, those with normal morphology were selected and incubated for 4 h in lentivirus solution. After several washes, blastocysts were transferred onto Ishikawa monolayers and cocultured for 48 h at 37°C in a 5% CO2 atmosphere. After a rotation of the plates, floated embryos were removed. The embryo attachment rate was examined by using an inverted microscope. For in vivo experiments, after incubated for 4 h in lentivirus solution and several washes, 12 expanded blastocysts with normal morphology of each group were transferred to the uterine horn of pseudopregnant ICR female mice. At 72 h post-transferred, mice were sacrificed and their uteri were dissected to measure implantation sites.
4.3 Cell Culture and Reagents
NIH/3T3 and 293T cells were cultured in DMEM (CGM101.05; CellMax, Lanzhou, China). JEG3 cells were cultured in EMEM (11700; Cary, Huzhou, China). HTR8/SVneo cells and Ishikawa cells were cultured in RPMI medium (C11875500BT; Thermo Fisher Biochemical, China). Cells were cultured at 37°C in a 5% CO2 atmosphere, and all culture media were supplemented with 100 U/ml penicillin and streptomycin (BL505A; Biosharp, Beijing, China) and 10% fetal bovine serum (CellMax, Lanzhou, China).
KRT18 antibody was purchased from Novus Biologicals (NPB2-67370; Littleton, CO, USA). Phalloidin was purchased from Thermo Fisher Scientific (A22284; USA). KRT18 fusion protein (Ag1260) and E-cadherin fusion protein (Ag15085) were purchased from Proteintech (Wuhan, Hubei, P.R.C.).
4.4 Small Interfering RNA (siRNA) Transfection and Lentivirus Infection
Control siRNA and KRT18 siRNA were obtained from Shanghai GenePharma (Shanghai, China). For transient transfections, Lipofectamine 3000 (Invitrogen) was used according to the manufacturer’s instructions. KRT18 siRNA sequences:
5′- GGUUCCCGGAUCUCCGUGUTT-3′,
5′- GCUGAUGACUUUAGAGUCATT-3′,
and 5′- GAGCUAGACAAGUACUGGUTT-3′.
KRT18 knockdown and control lentiviruses were obtained from GeneChem (GeneChem, Shanghai, China). Lentivirus infection was conducted according to the manufacturer’s instructions. KRT18 siRNA sequences: sense (5'-3')
5'-GGAAGUCCAAGGUCUGGAATT-3', 5'-CCUCCAGACCUUGGAGAUUTT-3', and 5'-CCAUGCAAACUGUGCAGAATT-3'; antisense (5'-3')
5'-UUCCAGACCUUGGACUUCCTT-3', 5'-AAUCUCCAAGGUCUGGAGGTT-3', and 5'-UUCUGCACAGUUUGCAUGGTT-3'.
4.5 Immunofluorescence Staining and Confocal Microscopy
For embryo and cell immunofluorescence staining, embryos at different stages or cells were fixed in 4% w/v paraformaldehyde (PFA) for 30 min at room temperature. After that, permeabilization was performed with PBS containing 0.5% Triton X-100 for 20 min followed by blocking in 1% w/v bovine serum albumin for 1 h. Then, primary antibodies were applied at 4 °C overnight. Embryos or cells were then treated with Alexa Fluor 568-conjugated and 488-conjugated secondary antibodies after being washed three times with PBS containing 0.01% Triton X-100 and 0.1% Tween-20 for 1 h at room temperature. Hoechst (33342, MA0126; 1 mg/ml; Meilunbio, Dalian, China) staining was used to visualize cell nuclei. A confocal microscope (Carl Zeiss, Oberkochen, Germany) was utilized for fluorescent confocal analysis.
4.6 RNA Extraction and Real-Time Quantitative PCR (qRT-PCR)
Total RNA was isolated using an RNA-Quick Purification Kit (ES Science, China) according to the manufacturer's protocol. The RNA concentration and quality were determined by using a NanoDrop ND2000. Next, Prime HiScript II qRT SuperMix (Vazyme, Nanjing, China) was applied for reverse transcription. Then, real-time PCR was conducted on a real-time PCR system (Life Technologies, USA) using SYBR Green qPCR Mix (Beyotime, China). The following primers were used: KRT18 (human, forward, 5′-TCGCAAATACTGTGGACAATGC-3′; reverse, 5′- GCAGTCGTGTGATATTGGTGT-3′; mus, forward, 5′-CAGCCAGCGTCTATGCAGG-3′; reverse, 5′-CCTTCTCGGTCTGGATTCCAC-3′), GATA2 (human, forward, 5′- CAGCAAGGCTCGTTCCTGTT -3′; reverse, 5′- GGCTTGATGAGTGGTCGGT-3′) and GAPDH (human, forward, 5′- CGGAGTCAACGGATTTGGTCGTAT -3′; reverse, 5′- AGCCTTCTCCATGGTGGTGAAGAC -3′).
4.7 Western Blotting
Cell lysates were first treated with RIPA buffer with phosphatase and protease inhibitors. After separation by electrophoresis, the proteins were transferred to PVDF membranes (Millipore). Primary antibodies were incubated with the membranes at 4°C overnight. After 3 washes in TBST, the membranes were treated with HRP-linked anti-rabbit or anti-mouse IgG secondary antibodies (Cell Signaling Technology, USA). After 3 washes in TBST, the bands were imaged using an infrared imaging system (Licor Odyssey CLx infrared system).
4.8 Wound Healing Assay
For the cell motility assay, HTR8/SVneo cells (2×105 cells) that were treated with siKRT18-3 for 24 h were seeded in six-well plates. When the cells grew to 80–90% confluence, a scratch wound was made by using a 200-µL pipette tip. Images were taken at 0 h and 24 h after wounding. The scratch wound size was assessed by ImageJ software.
4.9 Transwell Assay
For the transwell assay, HTR8/SVneo cells were treated with siKRT18-3 for 24 h and starved with serum-free DMEM containing 0.2% BSA overnight. Then, 2 × 105 cells were added to the upper transwell chamber, which was coated with Matrigel. DMEM + 10% FBS was added to the lower chamber. After incubation at 37°C for 24 h, cells adhered to the lower surface were fixed for 15 min with 4% paraformaldehyde. Then, the fixed cells were stained with 0.005% crystal violet and counted in four fields per filter by ImageJ software.
4.10 JEG3 Spheroid Coculture Assay
For the coculture assay, Ishikawa cells were seeded at 0.6 × 106 cells per well in a 12-well plate 24 h before coculture. JEG3 spheroids were generated by shaking cells (at a density of 3 × 105 cells per well of 6-well plate) at 88 rpm for 16–18 h in culture medium under standard cell culture conditions. After Ishikawa culture medium was used to replace the medium (substitute FBS with 1% BSA), the spheroids were selected and transferred onto Ishikawa monolayers. Cocultures were incubated for 1 h, followed by centrifuging the plate at 145 rpm for 10 min. The attachment rate was determined after removing the nonbound spheroids. The outgrowth of JEG3 spheroids was measured by ImageJ 48 h after transfer.
Cocultures were incubated for 1 h, followed by centrifuging the plate at 145 rpm for 10 min. The attachment rate was determined after removing the nonbound spheroids. The outgrowth of JEG3 spheroids was measured by ImageJ 48 h after transfer. The embryo attachment rate was determined by using an inverted microscope.
4.11 MST
MST was performed according to a protocol reported previously[39, 40]. In brief, according to the standard protocol, a RED-NHS protein labeling kit (NanoTemper Technologies, Munich, Germany) was used to label His-E-cadherin fusion protein. Then, the labeled His-E-cadherin fusion protein was incubated with 2-fold serial dilutions of the GST-KRT18 fusion protein in MST-optimized buffer at a constant concentration (1 µM). Binding reactions were mixed and then incubated at room temperature for 15 min. Then, the mixtures were loaded into the instrument (Monolith NT.115; NanoTemper) after being enclosed in dedicated glass capillaries. The measurement times were as follows: fluorescence before 5 s, MST on 30 s, fluorescence after 5 s, and delay for 25 s. Then, 20 and 40% MST power were used to perform the measurement. Fnorm (normalized fluorescence) = F1 (fluorescence after thermodiffusion)/F0 (initial fluorescence or fluorescence after T-jump). The NanoTemper analysis tool was used to determine the Kd values.
4.12 Statistical Analyses
Statistical analyses were performed using GraphPad (La Jolla, CA, USA) Prism 8 software. The statistical significance of the differences was analyzed by Student’s t test. The mean ± sd was plotted. All statistical tests used a p value less than 0.05 to determine statistical significance.