1.1 Sample collection and cell processing
Prior to sample collection, the written consent was signed enrolled by patients, the study methodologies got the permission of the ethical committee of the First Hospital Affiliated with the University of Science and Technology of China, and all experiments and procedures conformed to the Helsinki Declaration. Normal human nucleus pulposus (NP) tissue (Pfirrmann grades I-II, n=8) was collected in patients with lumbar fracture receiving lumbar interbody fusion surgery, and degenerative human NP tissue (Pfirrmann grades IV-V, n=8) from IDD patients receiving discectomy. The NP tissue was collected during surgery, immediately rinsed three times by PBS in a sterile environment, and digested in 0.2% Type II collagen solution in pieces for 6 hours at 37 °C. Following separation, the NP cells were grown in DMEF12 with 10% FBS (GIBCO), 100 U/mL penicillin, 100 mg/mL streptomycin, and 1% L-glutamine. The cells were then kept at 37°C in a humidified incubator (5% CO2 and 95% air). Every two to three days, the cultured media was replaced.
1.2 RNA isolation
RNA isolation was performed with the TRIzol (Invitrogen) and an RNeasy mini kit (Qiagen) based on the manufacturers’ protocols. A NanoDrop ND-1000 spectrophotometer was applied to evaluate RNA purity and concentration. For subsequent analysis, total RNA was eluted in 100 μL of nuclease-free water and kept at 80°C.
1.3 Quantitative real-time PCR (qRT-PCR)
Reverse transcription (RT) and qRT-PCR kits (Takara Bio) were adopted to measure the expressions of mRNA in NP samples. The Takara Reverse Transcription Kit was applied to execute the RT reactions in a total volume of 10 mL (37°C for 15 min, 85°C for 5 min, and kept at 4°C). Then, the reaction mix included 10μl 2× TB Green PCR Mix, 0.4μl ROX Reference Dye II, 0.8μl Forward primers(10μM), 0.8μl Reverse primers(10μM), 2μl diluted RT product and 6 μl nuclease-free water. The PCR primers were FUBP1 (forward, CAACCAGATGCTAAGAAGAAAGTTGC; reverse, CCTCCTCTGCCAATTATGAATCC), NRF2 (forward, TCAGCGACGGAA AGAGTATGA; reverse, CCACTGGTTTCTGACTGGATGT), Bax (forward, CCCGAGAGGTCTTTT TCCGAG; reverse, CCAGCCCATGATGGTTCTGAT), Caspase-3 (forward, CTGAACAGCTCCGA GGAAAC; reverse, TGGATATTCAGCCCTTTTGG), Bcl2 (forward, GGTGGGGTCATGTGTGTGG; reverse, CGGTTCAGGTACTCAGTCATCC) and GAPDH (forward, GGAGCGAGATCCCTCCAA AAT; reverse, GGCTGTTGTCATACTTCTCATGG). The experiments were repeated three times independently. On a 7500 Real-time system from Applied Biosystems, all reactions were run in triplicate with the below conditions: 95 °C for 10 mins, then 40 cycles of 95 °C for 15s, and finally 60 °C for one minute, GAPDH as internal control. The 2−ΔΔCt technique was used to determine each target gene's relative expression levels.
1.4 Western blotting (WB) analysis
Briefly, cell pellets were solubilized in RIPA buffer with protease suppressor cocktail and sonicated on ice. Subsequently, by BCA protein assay kit, the protein concentration was determined. After separated by 10% SDS-PAGE gels, the proteins were then transferred to polyvinylidenefluoride membranes. Being blocked for 2h in 5% nonfat dry milk indoor, the membranes were kept for 12 hours with anti-FUBP1, anti-Cytc, anti-Bax, anti-Caspase-3, anti-Bcl2, and anti-GAPDH antibodies (all at the rate of 1:1000 from Abcam). Membranes were kept for two hours with goat anti-rabbit antibody (1:5000; Abcam) following washing in TBST (10 mmol/L Tris, pH 8.0, 150mmol/L NaCl, and 0.1% Tween 20). An improved chemiluminescence detection kit was used to visualize the proteins (Thermo Fisher Scientific). By blotting the same membranes with an anti-GAPDH antibody, normalization was carried out. Finally, the relative protein expressions were analyzed by Image J software.
1.5 TUNEL (TdT-mediated dUTP Nick-End Labeling) staining
The following incubations were performed on the deparaffinized sections: 20 g/ml proteinase K for 15 min, TdT reaction mix (10 U/ml TdT, 0.02 mM DIG-dUTP, pH 7.2) at 37°C for 60 min, 2× SSC for 15 min, 1% blocking reagent (Roche, Basel, Switzerland) for 30 min, alkaline phosphatase-conjugated sheep anti-digoxigenin antibody (1:2000; Roche) at 4°C at ambient temperatures for a night. Finally, Nuclear Fast Red was used to counterstain the parts. Similar procedures were followed for TUNEL labeling of cultivated H9C2 cells, however proteinase K antigen retrieval and counterstaining were skipped. Besides, the immunohistochemistry test was carried out following the TUNEL staining described above without counterstaining.
1.6 Flow cytometry
Flow cytometry detected the cell apoptosis in NP cells according to the instruction manual. Annexin V-FITC and PI staining was performed to analyze the percentage of early and late cell apoptosis. Briefly, NP cells were selected after treatment and washed twice with PBS. Subsequently, NP cells were transferred to a EP tube and cultured by 100 μL of binding buffer, 5 µl of PI and 5 µl of Annexin V-FITC in the darkness for 20 min. At last, 400 µl of binding buffer was supplemented, and the apoptotic NP cells were detected by flow cytometry (BD Biosciences, USA).
1.7 Immunofluorescence (IF) and confocal analysis
Immunofluorescence and confocal analysis was performed in accordance with a previously described protocol. Human NP cells from the different treatment groups were plated in laser confocal dishes where NP cells were cultured for 48 hours. Cells were fixed for 20 mins indoor with 4% paraformaldehyde, then for 15 minutes with 0.25% Triton X-100. After rinsing 3 times with PBS, the cells were blocked with 5% BSA for 30 min indoor. Then, the primary antibodies were applied to the cells and left overnight at 4°C. The cells were cleaned with PBS before being treated with secondary antibodies (AlexaFluor 488, AlexaFluor 594) for 1 hours. Subsequently, cell nuclei were counterstained with DAPI for 10 min. At last, fluorescence pictures were acquired by confocal microscope (ZEISS LSM 800).
1.8 Histological and immunohistochemical staining
Intervertebral discs were stained using histological and immunohistochemical methods (IVD). For inactivating endogenous peroxidase, the intervertebral discs were submerged in PBS with 0.3% H2O2 for 15 min at room temperatur, and incubated for 20 min with 1% BSA in PBST. Then, each disc was stained with H&E, Masson, and Alcian blue, and serial sections were used for immunohistochemical analysis. Subsequently, rabbit anti-FUBP1 antibody (Abcam) was applied to the sections and kept at 4°C for a night. Sections were first cleaned with PBS, then incubated with a biotinylated secondary antibody for an hour.
1.9 Cell transfection
NP cell culture was cultured for 24 hours before transfection after the initial cell density was kept at around 2×104 cells per well. The samples were divided into groups and transfected with si-NRF2, FUBP1 mimic, mimic control or inhibitor control (all from Life Technologies, Carlsbad, USA). The Lipofectamine 2000 was used for the transfection (Invitrogen, Carlsbad, CA, USA).
1.10 Dual luciferase assays
Dual luciferase assays were conducted by dual luciferase reporter assay kit (Beyotime). NP cells were kept in DMEF12 minimum essential medium with 10% FBS, and penicillin/streptomycin (100 U/mL; Gibco, Life technologies). For each well, 2 µl of X-tremegene HP is required for each 1 µg of plasmid transfected, the X-tremegene HP transfection reagent and the required plasmid together in 100 µl of opti-MEM were dissolved at this ratio, mixed well and leaved for 20 min. The culture medium in the well plate was replaced with 200 µl of opti-MEM medium, and added the plasmid and X tremegene HP into the cells and incubated for 5-6 h in a 5% CO2 incubator at 37°C, then changed new complete medium containing 10% serum. In the same manner as previously described, cells at 60% confluence were transfected with 2 g of the mCrx-Luc reporter by CaCl2 (0.25 M) and boric acid-buffered saline (1×), pH 6.75. After 48 h, dual-luciferase tests were carried out.
1.11 Establishment of the rat IDD model
Sprague-Dawley male rats that were three months old and weighed 380 grams from the USTC Animal Experiment Center, and housed in special pathogen-free environments, were randomly assigned to normal control group (NC; n=5), IDD model group (IDD; n=5), or IDD model with FUBP1 therapy (IDD+ FUBP1; n=5). were in three groups with n=5. By needle puncturing the annulus fibrosus (AF), the rat model of IDD was created. Chloral hydrate (250 mg/kg) was injected intraperitoneally to anesthetize all the rats. After induction of anesthesia, the Co6-Co7 level rat coccygeal discs were punctured by a syringe needle to generate IDD in the rats in the IDD and IDD+FUBP1 groups. The Hospital Ethical Committee has given the approval to this experiments.