TCGA data processing
Differentially expressed miRNAs: The level3 miRNA sequencing data were downloaded from TCGA database (https://cancergenome.nih.gov/). Some data were acquired from a total of 49 patients, including miRNA sequencing data of both cancer tissues and matched normal tissues. The different expression of miRNAs between cancer and the match normal tissues were calculated using edgeR package. Afterwards, the fold changes (FCs) of individual miRNA expressions were analyzed, and miRNAs, those differentially expressed with log2|FC| > 2.0 and P < 0.05, were treated to be significant.
miR-1269a expression: The reads per million miRNA data of miR-1269a were log2 transformed and the expression of miR-1269a in 49 paired liver cancer cancer tissues and matched normal tissues were calculated.
Associations of miR-1269a expression level and patients’ suvival: The level3 miRNAs sequencing data and the relative clinical prognosis information were abtained from TCGA database. The inclusion criterion was set as follows: cancer tissue samples containing both miR-1269a sequencing data and prognosis information. 366 patients were in the database. The reads per million miRNA data of miR-1269a were log2 transformed. Patients with liver cancer were stratified into high level and low level expression groups through the median of miR-1269a expression. The survival value of miR-1269a was evaluated with Kaplan-Meier curve and Log-rank method using survival package in R language.
Ethics statements and liver cancer sample preparation
50 patients who had been diagnosed with liver cancer from Shanghai Pudong Hospital Affiliated to Fudan University (Shanghai, China) were recruited in this study. For the usage of clinical materials, written informed consents from all patients were obtained. All methods in this research were approved by the Research Medical Ethics Committee of Shanghai Pudong Hospital. Paired tumor and adjacent non-tumour tissues (n =50, 26 men and 24 women) near the cancerous region were resected and immediately incubated in RNAlater solution (Ambion, Thermo Fisher Scientific, Inc., Waltham, MA, USA) overnight and then stored at −80 °C. Subsequently, RNA from the tissues were extracted for quantitative Real-time PCR analysis.
Cell culture
Liver cancer cell lines HepG2 (hepatoblastoma cell line) [24] and Hep3B (hepatocellular carcinoma cell line) were purchased from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences, Shanghai Institute of Cell Biology, Chinese Academy of Sciences. The cells were cultured in high-glucose Dulbecco’s modified Eagle’s medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA). The cells were cultured in a humidified incubator containing 5% CO2 at 37℃ (Thermo Fisher Scientific, Inc.).
Plasmids, lentivirus supernatants and infection of cervical cancer cells
The miR-1269a sponge sequences were as follows:
MiR-1269 a-sponge PF:
AATTCCCAGTAGCTGGACAGTCCAGCCAGTAGCTGGACAGTCCAGCCAGTAGCTGGACAGTCCAGCCAGTA
GCTGGACAGTCCAGCCAGTAGCTGGACAGTCCAGCCAGTAGCTGGACAGTCCAGCCAGTAGCTGGACAGTCCAGCCAGTAGCTGGACAGTCCAGG;
MiR-1269 a-sponge PR:
GATCCCTGGACTGTCCAGCTACTGGCTGGACTGTCCAGCTACTGGCTGGACTGTCCAGCTACTGGCTGGACTGTCCAGCTACTGGCTGGACTGTCCAGCTACTGGCTGGACTGTCCAGCTACTGGCTGGACTGTCCAGCTACTGGC TGGACTGTCCAGCTACTGGG.
The miR-1269a sponge sequences were ligated into the pLVX-IRES-ZsGreen1 vector that expressed the green fluorescent protein (ZsGreen). For viral packaging, 293T cells were co-transfected with lentiviral plasmids with FuGene HD transfection reagent (Roche Diagnostics, Basel, Switzerland). The virus were harvested at 48 h following transfection through filtering the medium to remove cell debris. For generation of miR-1269a sponge overexpressing HepG2 and Hep3B cells, 2×105 cells were seeded into six-well plates 12 h before infection. Subsequently, the cell culture medium was replaced with 1 ml fresh medium in addition to 1 ml virus-containing supernatant supplemented with polybrene (8 µg/mL, Sigma, St. Louis, Unite States). 72 h following infection, ZsGreen positive cells were selected by Flow cytometry using FACS Calibur (BD Biosciences, Unite States). ZsGreen positive cells were then seeded into six-well plates to form cell lines and processed for further analysis. To detect the infection efficiency, cells with ZsGreen protein were investigated with fluorescence microscopy (Nikon, Tokyo, Japan).
Cell proliferation assay
Cell proliferation was determined using Cell Counting Kit-8 (CCK8) assay and clone formation assay. For CCK8 assay, Cancer cells were seeded in 96-well plates at a density of 1×103 cells/well. Following incubation for 12, 36 and 60 h, 10 µl reagent (Dojindo, Kumamoto, Japan) was added to each well and subsequently incubated for 2 h at 37℃. The resulting absorbance at 450 nm was measured with SpectraMax M5 (Thermo Fisher Scientific, Unite States).
For clone formation assay, 1000 liver cancer cells were cultured in each well of 6-well plates. Then the cells were cultured in a humidified incubator with 5% CO2 at 37℃ for 10 day. Afterwards, the cells were fixed with methanol and for 20 min. At last, the liver cancer cells were stained with crystal violet and the pictures were taken with a camera (Nikon, Tokyo, Japan).
Immunofluorescence staining
1×104 liver cancer cells were incubated in 24-well plates each well. After 48 h, the cells were fixed with 4% paraformaldehyde for 20 min. Afterwards, the cells were washed by PBS and permeabilized with 0.25% Triton X-100 for 5 min, then blocked using PBS (10% FBS) for 1 h. Next, cells were incubated with primary antibody anti Ki67 (abcam, Cambrage, England) in PBS (10% FBS) overnight at 4℃. After rinsing with PBS, the cells were treated with secondary antibody in PBS (10% FBS) for 2 h at room temperature. At last, the cells were incubated with Hochest 33342 for 5 min, then washed with PBS and imaged using fluorescence microscopy (Nikon).
Reverse Transcription and Real-Time Polymerase Chain Reaction (qRT-PCR)
Total RNA was isolated with Trizol reagent (TaKaRa, Dalian, China) according to the manufacturer’s manual and guideline. For each sample, 500 ng RNA was reverse transcribed to cDNA with Prime-Script RT reagent kit (TaKaRa). The resulting cDNA was amplified using Takara Ex Taq PCR kit (TaKaRa). qRT-PCR was performed with the Stratagene Mx3000 QPCR system (Stratagene, Foster City, CA) and analyzed via the △△CT method. The qRT-PCR sequences used in this study were shown as follows: Gapdh-PF: GGAGCGAGATCCCTCCAAAAT, Gapdh-PR: GGCTGTTGTCATACTTCTCATGG; Rbms3-PF: TGGACCATCCCATGTCAATGC, Rbms3-PR: CCAACGAAAGGTGATTCATCTGC; c-Myc-PF: GTCAAGAGGCGAACACACAAC, c-Myc-PR: TTGGACGGACAGGATGTATGC.
Luciferase reporter assay
To make the Rbms3 3’UTR vector, PCR was carried out with the lucRbms3-F: cgcctcgagGTAGGACAAGCTGCATTTTCTG and lucRbms3-R: cgcaagcttACGTTAGCCCCCAACTACAAA primers (the lower-case letters represent restriction enzyme sites for XhoI and HindIII). The resulting PCR fragment was ligated to pGL-3 luciferase reporter vector opened with XhoI and HindIII. 293T cells grown in 24-well plates were transfected with 50 nM Control miRNA, miR-1269a mimics and miR-1269a inhibitor (Ribobio Corporation, Guangzhou, China)), 0.5 ug pGL-3 luciferase reporter vector that contain the Rbms3 3’UTR, and 0.02 ug a control Renilla luciferase vector (pRL-TK; Promega) in the presence of Fugene HD (Roche). The activities of Firefly and Renilla luciferase in the cell lysates were detected with a Dual-Luciferase Reporter Assay System (Promega) at 24 hours after transfection.
Animal experiments
10 Male Balb/c nude mice (4 weeks old, SLAC Laboratory Animal Company, Shanghai, China) were bred according to National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978) in Animal Center of Shanghai University of Medicine & Health Sciences. The Institutional Animal Care and Use Committee of Shanghai University of Medicine & Health Sciences approved all the protocols. The mice were maintained on a 12 h light/12 h dark schedule (lights on from 7:00 to 19:00). The food and water were allowed ad libitum in the SPF house. 5×106 Hep3B cells from control and miR-1269a sponge groups were injected subcutaneously into the right forelimb axillary of mice. Then the mice were euthanised using pentobarbital sodium intraperitoneally (120 mg/kg) 1 h after the treatment. Tumors were excised and the weight was evaluated.
Statistical Analysis
All statistical analyses were analyzed using SPSS 17.0 software. Data were analyzed using t-test and one-way ANOVA. Error bars represented the SEM of three independent experiments. All the data were represented as mean ± SEM. *, ** and *** were indicative of p<0.05, p<0.01, and p<0.001, respectively.