Cells culture and ethics statement
The Human PASMCs used in the experiment were isolated from the distal pulmonary arterioles in patients undergoing pulmonary lobectomy. This study was approved by the Medical Ethics Committee for Clinical Research of Zhongda Hospital (Nanjing, China). All subjects signed informed consent before the research. After removing the adventitia and intima of the pulmonary artery, the pulmonary artery smooth muscle was cut into small pieces of 1 × 1 mm2, and then transferred to a culture flask. Isolated PASMCs were cultured in DMEM/F12 (Hyclone, CA) containing 10% fetal bovine serum (FBS) (Gibco, San Diego, NY, USA), supplemented with 100U/mL penicillin, and 100 mg/mL streptomycin in a humidified atmosphere containing 5% CO2 at 37 °C. For hypoxic condition, PASMCs were incubated in the condition containing 1% O2,94% N2 and 5% CO2. 3–7 passages of PASMCs were used in the experiment. Cells were starved in serum-free DMEM/F12 medium for 24 h before all experiments.
RNA interference, construction of the lentiviral vector and cell transfection
Lentivirus encoding full length of AC068039.4 sequence, specific short hairpin RNA targeting AC068039.4 (sh-AC068039.4) tagged with Green fluorescent protein (GFP) and the negative control lentiviral vectors tagged with GFP were constructed by Genechem Co. (Shanghai, China). Recombinant lentiviral vectors noncoding miR-26a-5p mimic, mimic negative control (NC), miR-26a-5p inhibitor and inhibitor NC were also designed and synthesized by Genechem Co. to regulate the expression of miR-26a-5p. The sequences for each were listed in Table 1. The PASMCs were cultured in 6-well plates 24 h before transfection with a cell density of 70–80% and PASMCs were transfected following the manufacturer’s introductions. Transfection reagents were removed after 24 h, and the cells were further cultured in DMEM containing 5% FBS. 3–4 days after transfection, fluorescence expression was observed using fluorescence microscopy and transduction efficiency was assessed by GFP expression > 80%. PASMCs were collected used for subsequent experiments and shRNA with the best silencing effect tested by qPCR was used to perform the following experiment.
Table 1
Sequences of sh-AC068039.4, miR-26a-5p-mimic and miR-26a-5p-inhibitor
Gene | Sequence (5’-3’) |
shAC068039.4-1 | AGAACTACAAGGAGAAATA |
shAC068039.4-2 | CCACAATGCAATTATGTTA |
shAC068039.4-3 | AATAATGCCATGTGTGAAA |
miR-26a-5p mimic | UUCAAGUAAUCCAGGAUAGGCU |
miR-26a-5p inhibitor | AGCCTATCCTGGATTACTTGAA |
Cell proliferation assay
The cells were seeded in 96-well plate at a density of 5 × 103 cells per well, and 10 µl of CCK-8 reagent (KGA317, KeyGEN BioTECH, Nanjing, China) was added to each well, then the cells were incubated in a 37℃ incubator for 4 hours. A microplate reader (SYNERGY/H4, BioTek, USA) was used to detect the absorbance value of the cells at a wavelength of 450 nm (OD 450 nm) to analyze the proliferative activity.
Cell migration assay
Transwell Chambers (Corning, USA) was used to perform cell migration assay to evaluate the migration potential of PASMCs according to the manufacturer’s introductions. The upper Transwell chamber, where PASMCs with different treatments were added, contains 0.5% FBS medium, while the lower chamber was filled with 10% FBS medium. After culturing for 18 h, cells were washed with PBS and stained with crystal violet at room temperature for 15 min and then dried. A microscope was used for observation (Olympus, Japan).
Cell cycle progression
Cells were collected after trypsinization, centrifuged and resuspended in 1 ml cold PBS. Then, cells were washed twice with PBS and fixed with precooled 70% ethanol at 4℃ overnight. The fixed cells were collected after centrifugation, and then resuspended in 500µL of staining buffer, 100 µl of RNaseA was added, then add 25µL propidium iodide, the suspension was subjected to a water bath at 37℃ for half an hour. Finally, the cells were filtered through a 400 mesh sieve, flow cytometry was used to detect whether the cells are in the G0/G1, S or G2/M cell cycle.
Total RNA isolation and quantitative reverse transcription PCR
Total RNA from PASMCs under different treatments was extracted with RNAiso Plus reagent (9109, TaKaRa, Shiga, Japan) according to the manufacturer’s protocol. Nanodrop 2000 (Thermo Scientific, MA, USA) was used to measure concentration of RNA. Equal amounts of total RNA were reversed transcribed into cDNA using Prime-Script RT kit (RR047A, Takara, Japan). RT-PCR was performed with the TB GreenTM Premix Ex Taq TM II (RR820A, Takara, Japan) and Prism 7500 SDS (Thermo Scientific, MA, USA). The CT values of the target genes were recorded, relative gene expression was calculated using the 2−ΔΔCT method and β-actin or U6 were used as internal references. Primers sequences are listed in Tables 2.
Table 2
Sequences of the primers for quantitative PCR
Gene | Sequence (5’-3’) |
lncRNA AC068039.4 | Forward: GTGCCGAGATTGCAGCCTCTG |
| Reverse: AGACGCTCCTCACTTCCTAGACG |
miR-26a-5p | Forward: CGCGTTCAAGTAATCCAGGA |
| Reverse: AGTGCAGGGTCCGAGGTATT |
| RT Primer: GTCGTATCCAGTGCAGGGTCCGAGGT |
TRPC6 | Forward: CATGACGGCTTTAGAACTTAGC |
| Reverse: CTTCAGTGTTTCTGCACAGATC |
PCNA | Forward: GAAGGTGTTGGAGGCACTCAAGG |
| Reverse: GCAGCGGTAGGTGTCGAAGC |
Cyclin A1 | Forward: GGCACAGACCCAAAGCACACTAC |
| Reverse: AACCTCCACCAGCCAGTCCAC |
Cyclin D1 | Forward: GCCCTCGGTGTCCTACTTCAAATG |
| Reverse: TCCTCCTCGCACTTCTGTTCCTC |
Cyclin E1 | Forward: GTGTCCTGGATGTTGACTGCCTTG |
| Reverse: CGCACCACTGATACCCTGAAACC |
β-actin | Forward: GGCACCCAGCACAATGAAG |
| Reverse: CCGATCCACACGGAGTACTTG |
U6 | Forward: CTCGCTTCGGCAGCACA |
| Reverse: AACGCTTCACGAATTTGCGT |
Western blot analysis
Cell total protein extraction kit (KGP2100, KeyGEN BioTECH, Nanjing, China) was used to extract total cellular proteins, and the protein concentration was measured using the BCA Detection Assay Kit (KGP902, KeyGEN BioTECH, China) according to the manufacturer's instructions. An equal amount (20 µg) of the extracted proteins were subjected to electrophoresis on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to a PDVF membrane (Millipore, Billerica, MA, USA). Membranes were blocked in TBST containing 5% non-fat milk for 1 h and incubated with primary antibody overnight. Antibodies used in the experiment included: anti-TRPC6 antibody (ab62461), anti-PCNA antibody (ab92552), anti-Cyclin A1 (ab53699), anti-Cyclin D1 (ab53699), anti-Cyclin E1 (ab133266) and anti-ACTIN antibody (ab8226) were purchased from Abcam (Cambridge, UK), the next day the PVDF membrane was incubated with a secondary antibody (Beijing TDY Biotech Co., Ltd., Beijing, China) for 1 hour. An ECL detection kit (GE Healthcare, UK) was used for blots visualization using and bolts were exposed with X-ray film.
Dual luciferase reporter assay
The AC068039.4 full length and wild-type (WT) 3′-UTR of TRPC6 were synthesized and cloned to pmirGLO Dual-Luciferase Vector (Promega, Madison, WI, USA). The predicted binding site was mutant as MUT-AC068039.4 and Mut-TRPC6. WT or MUT plasmid and miR-26a-5p mimics were co-transfected into Human embryo kidney 293 (HEK293) cells for 24 h. Cells were harvested and the relative luciferase activity was determined by using a Dual-Luciferase Reporter Assay System (Promega).
Microarray analysis
Total RNA was extracted from PASMCs induced by hypoxia and controls, lncRNA microarray analysis was performed by Genechem Co. (Shanghai, China). The lncRNA microarray analysis identified 698 up-regulated lncRNAs and 513 down-regulated lncRNAs in hypoxia induced PASMCs compared with PASMCs cultured under normoxic condition (fold change > 2.0 and P value < 0.05).
Statistical Analysis
SPSS 22.0 software (SPSS, Chicago, IL, USA) was used for analysis. Data were expressed as mean ± standard deviation. Independent sample student’s t test was used for the comparison between two groups, and one-way ANOVA followed by Dunnett ’s test was performed to evaluate differences among groups. P < 0.05(*) was considered statistically significant, P < 0.01 (**) was regarded as highly significant difference. All experiments were performed at least three times.