Sample collection and isolation of E. coli strains from goat kids
A study was conducted in hebdomadic goat kids that showed acute diarrhoea with pasty greenish faecal matter soiling the perianal region. Faecal swabs were collected from 32 goat kids born between September-November (kidding season) from various unorganised herds in an organised goat farm. For bacteriological culture, swabs were washed with 1.0ml of sterile PBS and vortexed before inoculation to culture media. They were cultured in MacConkey's agar (MCA) and Eosin Methylene blue agar (EMB) and incubated at 37ºC. The colonies obtained of Escherichia coli were gram stained, and specific biochemical tests like Indole test and Triple sugar iron agar tests were conducted. The lactose fermenting colonies of MCA were selectively streaked on Congo-Red dye agar and incubated at 37°C for 72 hours, which resulted in the development of colonies with brick red colour.
Molecular characterisation of E. coli by PCR:
DNA extraction was performed using the Nucleopore® DNA Kit (Genetix) implementing the manufacturer's protocol from pure sub-cultured MCA colonies. The DNA is then used to detect EPEC and shiga-toxin-producing (Stx) producing E. coli (STEC) based on the conventional PCR (cPCR) detection using bfpA and stx1 gene, respectively. The cPCR primers for bfpA were same as the SYBR green real-time primers designed in-house in the laboratory, while the stx1 gene was amplified using stx1F: 5'CACAATCAGGCGTCGCCAGCGCACTTGCT3' and stx1R: 5'TGTTGCAGGGATCAGTCGTACGGGGATGC3' (Talukdar et al. 2013). The identification of E. coli molecularly was made by PCR amplification of the universal stress protein A (uspA) gene utilising species-specific primers (F-5'-CCGATACGCTGCCAATCAGT-3' & R-5- ACGCAGACCGTAGGCCAGAT-3') (Fig: 1). The annealing temperature was kept at 55 °C for 1 min. The amplified stx1 gene was sequenced by Sanger's dideoxy method using the BigDye terminator kit where the same sample was subjected to DNA isolation for the screening of EPEC by using bfpA SYBR green real-time PCR. The EPEC colonies with brick red colour in Congo-Red dye agar isolated were also used for molecular screening by bfpA SYBR green real-time PCR. Sequence identity plot was done to compare the nucleotide composition and point mutations in the coding region of the STx1 gene of the above-isolated strain.
Molecular screening of EPEC using bfpA gene-based SYBR-green real-time PCR
Bundle forming pilin protein A gene primers: Size of product 158bp
bfpA F: 5′-ATGGTGCTTGCGCTTGCTGC-3′,
bfpA R: 5′-AATCCACTATAACTGGTCTGC-3′
Antibiotic susceptibility testing
EPEC was identified based on the modified Kirby Bauer Disk diffusion (Bauer et al. 1996) method, as per the CLSI (Clinical and laboratory standard Institute) guidelines. Antibiotic susceptibility was put up using antibiotic discs of Himedia- Mumbai, India. Set of drugs include Amikacin (30µg), Amoxy-Clavulanic acid (20/10 µg), Ampicillin (10µg), Ceftriaxone (30µg), Ceftazidime (30µg), Ceftazidime-Clavulanic Acid (30/10µg), Ciprofloxacin (5 µg), Co-trimoxazole (1.25/23.75 µg), Cefotaxime (30µg), Gentamicin (10 µg), Norfloxacin (10 µg), Aztreonam (30 µg), Cefepime (30µg), Meropenem (10 µg), Piperacillin-tazobactam (100/10 µg), Nitrofurantoin (300 µg), Colistin (10 µg) were tested for the three of the isolated EPEC strains (1873, 1845, B677). In-vitro presence of Extended-Spectrum Beta-Lactamase (ESBL) was also confirmed according to CLSI guidelines. Phenotypic evidence of ESBL development is confirmed when a difference of ≥5mm is observed between the zone diameters of either cephalosporin (ceftazidime) disc and their respective cephalosporin/clavulanate (ceftazidime-clavulanic acid) disc (Wayne, 2011).
Sample collection and isolation of bacteriophages:
For the isolation of bacteriophages, water samples were collected from different Ghats (Assi Ghat, Tulsi Ghat and Manikarnika Ghat) of river Ganges from Varanasi in a sterile plastic container. A sample from the water specimen was treated with 1% chloroform (v/v) for 10 minutes with continuous vortexing/inversion for bacteriophage isolation. It was later centrifuged for 10 minutes at 10778xg. The supernatant, collected was flooded on the 90mm Mueller-Hinton Agar (MHA) lawn culture (4h old EPEC cultured in log phase). It was incubated overnight at 37ºC. After 24h of incubation, the lawn culture is washed with 4 ml TMG (Tris HCL, Magnesium Sulphate, Gelatin pH 7.4) buffer and treated with 1% chloroform vortexing/inverting for 10 minutes. Soon after the chloroform treatment, it is centrifuged for 10 minutes at 10778xg. The supernatant is transferred carefully to another properly autoclaved 1.5 ml centrifuge tube without disturbing the sedimented lysed bacteria. The whole process of centrifugation repeated four times. Again a 4hr old lawn culture of the bacterial host (EPEC) was prepared. As mentioned earlier, the supernatant collected by the procedure was dropped on the plate and was incubated for 24h at 37ºC. After incubating for 18-24hr, the surface with clear plaques was swabbed with TMG buffer by properly autoclaved swab buds and collected in 1.5 ml centrifuge or eppendorf tubes further processed. The same centrifugation process is repeated, as mentioned above, to pellet the bacterial and cell debris at 10778xg for 10 minutes. The purified supernatant was collected and was preserved at 4º C for further use.
Isolation of different bacteriophage strains from cocktails:
Cocktail isolated for all the three strains 1873, 1845, B677 is a mixture of different bacteriophages separated into different strains by soft agar overlay method (Kropinski et al. 2009). The soft agar is kept at a molten state at a temperature of not more than 40-43°C in the water bath. Bacterial and phage suspension is added in it which is further poured on the MHA plates and incubated for 18-24h at 37° C. After incubation, different morphological plaques of different sizes are observed which were later cut out and put into Luria-Bertani (LB) broth and was incubated overnight at 37° C. A total of 5 different plaques were cut out, and after incubation, they were treated with 1% chloroform (v/v) for 10 minutes and were centrifuged at 10778xg for 10 minutes. The supernatant obtained was transferred to another 1.5 ml centrifuge tube, and the process of centrifugation is repeated three more times.
Isolation of bacteriophage DNA:
Isolated phage lysate (1010 PFU/ml) was transferred in an eppendorf, and DNAse (10mg/ml) was added and incubated for 30min at 37°C for degradation of bacterial DNA. After incubation, SDS (Sodium Dodecyl Sulfate) and proteinase K were introduced and was further incubated at 37°C for 1hr. Later, an equal volume of PCI (25:24:1) (Phenol/Chloroform/Isoamyl alcohol) was added and was centrifuged at 10778xg for 10 minutes. The aqueous phase was collected, and then an equal volume of CI (24:1) (Chloroform/Isoamyl alcohol) was added and centrifuged at 10778xg for 10 minutes. RNAse (10mg/ml) was added to the aqueous phase and was incubated for 30 minutes at 37°C. An equal volume of Isopropanol alcohol was added after incubation, and the solution was kept at room temperature. The suspension was centrifuged, and the pellet was washed with 70% ethanol and then again centrifuged at 10778xg for 10 minutes. Pellet was dried at 37°C for 1-2h, and was dissolved in TE (Tris-Cl-EDTA) and was stored at -20°C. The concentration and quality of isolated DNA were measured using a NanoDrop Bioanalyzer spectrophotometer (Thermo Scientific) at 260nm.
Characterisation of bacteriophages
Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) is a technique that is a quick, robust, precise and highly cost-effective fingerprinting method (Ranjbar et al. 2017). ERIC-PCR was applied against the harvested bacteriophage DNA for molecular genotyping where its PCR products were run on 1.2% gel electrophoresis for analysis. For DNA amplification, ERIC-PCR forward and reverse primers were used 5'-ATG TAA GCT CCT GGG GAT TCA C-3' (F) and 5'-AAG TAA GTG ACT GGG GTG AGC G-3' (R) (Versalovic et al. 1991). The process was performed in the total volume of 25µl, including 5µl of template DNA. A total of 25µl was put up for PCR where 5 µl of the master mix constitutes, 1.6µl/pm of forward and reverse ERIC primer. Finally, the thermocycler (BioRad) was programmed with the annealing temperature at 41°C (Versalovic et al. 1994; Szczuka et al. 2004). The resultant product is then run on 1.2% gel electrophoresis for 45 minutes, loaded by EtBr (Ethidium Bromide), with a 100bp of a ladder (DNA marker) as a standard measuring means and the resultant bands were observed in UV light and photographed via gel doc CMOS camera for image capturing.