- Construction of fgf21-glp1-IgG4fc lentiviral expression plasmid
pGSI-fgf21-glp1-IgG4fc (synthesized by Taihe Biotechnology) was used for subcloning of fgf21 and glp1-IgG4fc gene to the lentivector pCDH-EF1 (Addgene) with EF1α promotor. The amino acid sequence and the nucleotide sequence of the fgf21+ glp1-IgG4fc gene were listed in the supplementary materials. Primers for amplifying the cDNA of the fgf21+ glp1-IgG4fc gene (forward 5′- CGCGGATCCGCCACCATGGACTCGGACGAGACC -3′, reverse 5′- ACGCGTCGACTCATTTACCCGGAGACAG -3′) were synthesized from TsingKe (Beijing). The glp1-igg4fc gene is abbreviated as glp1 gene.
- Lentivirus production
Lentiviral vector plasmids and the packaging plasmids (psPAX and pMD.2G) were purchased from Addgene. Lentiviral particles with pCDH-EF1-FGF21, pCDH-EF1-FGF21+GLP1 and pCDH-EF1-GLP1 produced through transfection of HEK293T packaging cells with 3rd generation plasmids system. 293T cells were transfected with 24 µg of plasmids, 48 µl of Lipofectamine LTX and 24 µl of PLUS reagents, and the proportions of pMD. 2G, psPAX, and pCDH-EF1 plasmid were 1:2:3. The supernatants were collected at 24 and 48h after transfection, filtered by 0.45 μm filters, and harvested by ultrafiltration with 100 kDa spin column (Millipore) at 4°C and 4,000g for 30 min. Lentiviral particles were dispensed in aliquots, and stored at - 80 °C until use. Transfection efficiency was examined by EGFP using flow cytometry (Beckman), and viral titer was determined according to the equation: virus titer (pfu/ mL) = cell number in each well × virus dilution factor × 10/ volume of added virus fluid (mL).
- Mesenchymal stem cell culture, flow cytometry analysis, and characterization
Adipose tissue-derived mesenchymal stem cells were donated by Xijing Hospital and cultured in the same way as traditional ones. Briefly described as follows, to obtain the upper adipose tissue,the healthy adult adipose tissue extracted by liposuction was transferred to a 50mL centrifuge tube, fully washed with PBS, and centrifuged at 1500rpm for 5 minutes. 0.2% mixed collagenase (Type I, II and IV collagenases=1:1:1) was prepared, and adipose tissue: collagenase =1:1 was added to the mixed collagenase digestion solution. The adipose tissue was digested in a 37 °C shaker for 30 minutes. Digested adipose tissue was immediately added to α-mem cell culture medium containing 10% FBS(Gibco), namely complete medium. To precipitate cells and tissue clumps, the mixture was centrifuged at 1500rpm for 10 min. Cells were resuspended using complete medium and the undigested tissue was removed by nylon mesh. The cells were inoculated in a culture flask and incubated at 37 ℃ in a 5% CO2 incubator. Two days later, the unadhered cells were discarded and the adhered cells were washed gently with PBS. The cells continued to be cultured in complete medium.
MSCs were harvested from passage 5, washed three times with PBS, and then incubated with 0.1–10 μg/mL of conjugated antibody (BD Biosciences) for 30-min without light at room temperature. Then, the cells were examined by flow cytometer analysis. In total, above 95% of cells expressed CD73, CD90, and CD105, while 2% or less of cells expressed CD45, CD34, and HLA-DR. Released cells were negative for pathogenic microorganisms, HBV, HCV, HIV, cytomegalovirus, syphilis, and ALT, and endotoxin levels were found within 40 IU/L and 0.5 EU/mL, respectively. The total cells were counted, and cell viability (≥ 85%) was determined by Trypan blue staining.
- Transduction of MSCs with lentiviral particles and detection of target gene expression
The MSCs (<3 passages) were transduced with concentrative lentivirus with a multiplicity of infection (MOIs) of 40 for 6 h in the α-MEM medium containing 8 μg/ml polybrene. To detect the expression patterns of the FGF21 and GLP1 in MSCs, western blot analyses of cellular supernatant using anti-FGF21 and human IgG4-Fc monoclonal antibody were performed. To further measure the secreted the FGF21 and GLP1, culture medium (CM) of MSCs and MSCs transduced with pCDH-EF1-FGF21, pCDH-EF1-FGF21+GLP1, pCDH-EF1-GLP1, or pCDH-EF1-vector lentiviral particles were collected after incubation for 48 h. The secreted FGF21 and GLP1 in the medium of MSC culture were measured by ELISA (Abcam) according to the manufacturer’s protocol. When collecting the culture supernatant for testing, in order to ensure the same sample quantity, we inoculated different kinds of cells with uniform density, and then added the same amount of medium. After 48 hours of culture, the same amount of centrifuged culture supernatant was detected by ELISA and WB. For testing the proliferation of secreted MSCs, each MSCs were seeded in 96-well plates at 5 × 104 cells/well and preconditioned in culture medium. After 48 h incubation, 20 μl of CCK8 was added to each well and incubated for 4 h at 37 °C and absorbance was measured at 570 nm with a Quant microplate reader. All samples were analyzed as duplicates and samples with coefficient of variation (CV) values > 15% were excluded.
- Adipogenic and osteogenic differentiation
MSCs were cultured in a 24-well plate in complete a-MEM medium supplemented with adipogenic and osteogenic-inducing agents (Sigma Aldrich) at an initial cell density of 1×104 cells/well. After 2-3 weeks, cells were washed twice with PBS and fixed by 4% paraformaldehyde at room temperature for 30 min. Oil-red-O or alkaline phosphatase staining was applied to detect adipogenic and osteogenic differentiation.
- Western blotting
The cells were washed with PBS buffer and subsequently lysed using cell lysis buffer (Tiangen) with complete protease inhibitor mix (Biotool). Liver tissue were grinded and subsequently lysed using lysis buffer (Tiangen) with complete protease inhibitor mix (Biotool). The lysate and protein marker were run in SDS-PAGE gels (12% or 15%) respectively and transferred onto nitrocellulose membranes (MIllipore). Membranes were blocked with 5% milk in Tris-buffered saline plus Tween 20 (TBST) and exposed to primary antibodies against rabbit or mouse (1:3000, Abcam or Cell Signaling). Blots were probed with horseradish peroxidase (HRP)-conjugated goat anti-rabbit (or mouse) IgG (H+L) secondary antibodies and visualized using a Pierce ECL Western Blotting Substrate kit (Thermo Scientific) for signal detection.
- Relative quantitative real time polymerase chain reaction (RT-PCR)
Total RNA was extracted from cells using RNA extraction reagent (TRizol; Sigma). The total RNA isolated was reversed into cDNA using BioScript All-in-One cDNA Synthesis SuperMix (Biotool). Quantitative real-time PCR reactions were performed using the SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara) in 7500 Real-Time PCR System (Applied Biosystems). For normalization, threshold cycles (Ct-values) were normalized to β-actin/GAPDH within each sample to obtain sample-specific ΔCt values (ΔCt ¼ Ct gene of interest Ct β-actin/GAPDH). The values of 2-ΔΔCt were calculated to obtain fold expression levels. Primers for quantitative analyses of FGF21 gene (forward 5′- ATCGCTCCACTTTGACCCTG -3′, reverse 5′- GGGCTTCGGACTGGTAAACA -3′), GLP1-IgG4Fc gene (forward 5′- CCCCAAAACCCAAGGACACT -3′, reverse 5′- GCCATCCACGTACCAGTTGA -3′), srebp1c gene (forward 5′- CACTGTGACCTCGCAGATCC -3′, reverse 5′- ATAGGCAGCTTCTCCGCATC -3′), insulin gene (forward 5′- TCTCTACCTAGTGTGCGGGG -3′, reverse 5′-GCTGGTAGAGGGAGCAGATG -3′), β-actin gene (forward 5′- CCTGGCACCCAGCACAAT -3′, reverse 5′-GGGCCGGACTCGTCATAC -3′) and GAPDH gene (forward 5′- GGAGCGAGATCCCTCCAAAAT -3′, reverse 5′- GGCTGTTGTCATACTTCTCATGG -3′) were synthesized by TsingKe Company (Beijing).
- Animal experiments
In our study, BKS.Cg-Dock7m+/+Leprdb/Nju mice (T2DM model mice) model was used, and they were purchased from the Model Animal Research Center of Nanjing University. Thirty-six male BKS mice aged 6-8 weeks (>20 g body weight) were randomly divided into six groups. Each group contained six mice kept in two cages. The experiment was divided into six groups. Control group was injected with 100 μ l saline intraperitoneally. Liraglutide group was injected with 100 μ l liraglutide drug (0.5mg/kg, twice a week until the end of the experiment). MSC group (containing pCDH-EF1-vector lentiviral particles), MSC-FGF21 group, MSC-FGF21+GLP1 group and MSC-GLP1 group was injected with 100 μ l cell suspension (1×106 MSC cells suspended in 0.1 mL of physiological saline, once a week for three weeks). The drugs were administered by intravenous injection. Tail blood glucose was measured every week during the experiments. On day 28, peripheral blood was collected from the retro-orbital sinus of each mouse.
- Glucose stimulated insulin secretion (GSIS)
Rat INS-1 pancreatic β cell line was purchased from CCTCC (China Center for Type Culture Collection). The cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2. The culture medium was RPMI medium 1640 containing 11 mM glucose and supplemented with 10% FBS, 10 mM HEPES, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate and 50 μM mercaptoethanol. The culture medium was replaced every second day, and cells were passaged once a week following trypsinization.
To determine the effect of gene modified MSCs on GSIS, INS-1 cells were seeded onto 12-well plates and cultured for 24 hours. Then, the cells were washed two times with Krebs-Ringer bicarbonate buffer (KRBB, 129 mM NaCl, 4.8 mM KCl, 1.2 mM MgSO4, 1.2 mM KH2PO4, 2.5 mM CaCl2, 5 mM NaHCO3, 0.1% BSA, 10 mM HEPES, (pH 7.4) and 2.8 mM glucose) and starved for 2 hours in KRBB. The cells were incubated in fresh KRBB containing different MSCs conditioned medium for 1 hour in the presence of glucose. The supernatants were collected to measure insulin concentration.
- Fasting glucose and glucose tolerance tests
For the weekly fasting glucose test, the mice were starved overnight to assess glycemia. At the end of the experiment, after overnight fasting, the mice were administered glucose (1 g/kg) by oral gavage, and blood samples were collected from the tail vein for glucose determination. Glycemia was assessed using an Accu-Chek glucometer (Roche, Basel, Switzerland, http://www.roche.com), and the area under the curve was calculated.
- Statistical analysis
All statistical analyses were conducted using the software of SPSS. Data were analyzed using one-way ANOVA followed with the Tukey’s post-doc test or two-way ANOVA followed with the Bonferroni’s post-hoc test for the differences among the treatment means. P < 0.05 was considered significant.