Cytotoxicity assay
BMMs were seeded in 96-well plates (2×104 cells/well), a CCK-8 assay(Share-bio) was used to detect the cytotoxic effects of NaHS. Infinite M200 Pro NanoQuant absorbance microplate reader (Tecan, Switzerland) was used to measure absorbance.
Osteoclastogenesis assay and TRAP staining
RANKL (50ng/ml) and M-CSF (30ng/ml) were added to bone merrow-derived macrophages in 48-well plates (3×104 cells/well) to generate mature osteoclasts. TRAP was stained on day 8 in multinucleated osteoclasts fixed in pre-cooled 4° methanol for 10 minutes.
Ovariectomy-induced osteoporosis model
After the mice became insensitive (4% chloral hydrate, 5ml/kg), the back was skinned, the surgical site was disinfected, and a longitudinal incision was made on both sides of the back near the kidney area. The fascia was cut to separate the muscle and peritoneum, the pink ovarian tissue attached to the adipocytes was found, and both ovarian tissues were completely removed. In the sham group, small adipose tissue around the ovary was excised, the surgical needle was sutured layer by layer, and gentamicin that was continuously applied to the wound 3 days after the operation to prevent infection was disinfected. The removed ovarian mass was identified as ovarian tissue by freezing section (6 µm) and hematoxylin eosin (HE) staining under microscope.
Micro-CT analysis
Femurs or tibias from mice were fixed in 75% of ethanol at 4°C, and micro-CT scanning was performed on SkyScan 1176 (Bruker). CTAn software was applied to calculate the structural indices and reconstruct a 3D model. The region of interest (ROI) selected was 5 mm below the growth plate of bones, and the structural indices analyzed included BV/TV, BS/TV, Tb. N, Tb. Th, Tb.pf and Tb. Sp.
Bone histology and histomorphometry
The mice were sacrificed. Undecalcified femurs were made into bone sections after fixating in 4% of para-formaldehyde for 72 hours. As for histomorphometric parameters, H&E and TRAP staining and IHC of bone sections were used.
Luciferase assay
In triplicate, RAW264.7 cells were seed in 96-well plates and transfected with p-NF-kB-Luc in different concentrations. Cells were lysed after 48 hours. The absorbance was measured by Infinite M200 Pro NanoQuant absorbance microplate reader (Tecan, Switzerland).
Immunofluorescence
According to our previous studies, immunofluorescence was conducted(Tang, Xu et al. 2020).
Western blot
Western blot was conducted on the basis of our previous studies(Tang, Xu et al. 2020). The following antibodies were used for western blotting: anti-NFATc1 (Cell Signaling Technology, 8032, 1:1000); anti-c-FOS (Cell Signaling Technology, 2250, 1:1000); anti-p65 (Cell Signaling Technology, 8242, 1:1000); anti-Histone H3 (Cell Signaling Technology, 4499, 1:1000); anti-IkB-α (Cell Signaling Technology, 4814, 1:1000); anti-Phospho-IκBα (Cell Signaling Technology, 2859, 1:1000); anti-IKKα(Cell Signaling Technology, 61294, 1:1000); anti-IKKβ(Cell Signaling Technology, 8943, 1:1000); anti- Phospho-IKK-α/β (Cell Signaling Technology, 1023, 1:1000); anti-p100/p52(Cell Signaling Technology, 4882, 1:1000); anti-Ubiquitin (Cell Signaling Technology, 58395, 1:1000); anti-ACTIN (Cell Signaling Technology, 4970, 1:3000); and HRP-conjugated secondary antibodies (Boster, 1:5000).
Quantitative real-time PCR analysis
Quantitative real-time PCR analysis was conducted according to our previous studies(Tang, Xu et al. 2020). Primers used in the real-time PCR are listed in Table 1.
Table 1
Primers used in the real-time PCR
Genes
|
Upstream (5′-3′)
|
Downstream (5′-3′)
|
GAPDH
|
ACCCAGAAGACTGTGGATGG
|
CACATTGGGGGTAGGAACAC
|
CTSK
|
CTTCCAATACGTGCAGCAGA
|
TCTTCAGGGCTTTCTCGTTC
|
TRAP
|
CTGGAGTGCACGATGCCAGCGACA
|
TCCGTGCTCGGCGATGGACCAGA
|
V-ATPase-d2
|
AAGCCTTTGTTTGACGCTGT
|
TTCGATGCCTCTGTGAGATG
|
Flow cytometry
A total of 48 hours of NaHS (0, 0.3, 0.6 or 2.4 µM) exposure was performed on BMMs, followed by binding buffer suspension and staining with Annexin V-FITC and PI for 15 minutes. A FACS Canto II (BD) was used to acquire signals from 10,000 cells excited at 488nm, 585/42 (564 to 606 nm), and 702/64 (670 to 735 nm). FACSDiva (BD) software was used to analyze the results and to calculate the percentage of apoptotic cells within each population.
Statistical analysis
Student’s unpaired t-tests, two-way analysis of variance (ANOVA), and Dunnett’s test were adopted to analyze data. A P value, less than 0.05, was considered to be statistically significant, and all statistical analyses were conducted with the SPSS 20.0 software.