A chimeric vaccine protects saltwater crocodiles (Crocodylus porosus) from skin lesions caused by West Nile virus

doi:10.21203/rs.3.rs-2613856/v1

Download PDF

Article

A chimeric vaccine protects saltwater crocodiles (Crocodylus porosus) from skin lesions caused by West Nile virus

https://doi.org/10.21203/rs.3.rs-2613856/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 27 Jun, 2023

Read the published version in npj Vaccines →

You are reading this latest preprint version

West Nile virus (WNV) causes skin lesions in farmed crocodiles leading to depreciation of the value of their hides and significant economic losses. However, there is no commercially available vaccine designed for use in crocodilians against WNV. We tested chimeric virus vaccines composed of the non-structural genes of the insect-specific flavivirus Binjari virus (BinJV) and genes encoding the structural proteins of WNV. The BinJV/WNV chimera, is antigenically similar to wild-type WNV but replication-defective in vertebrates. Subcutaneous application of two doses of BinJV/WNV in hatchling saltwater crocodiles (Crocodylus porosus) elicited a robust neutralising antibody response and conferred protection against viremia and skin lesions after challenge with WNV. In contrast, mock-vaccinated crocodiles became viraemic and 22.2% exhibited WNV-induced lesions. This suggests that the BinJV/WNV chimera is a safe and efficacious vaccine preventing WNV-induced skin lesions in farmed crocodilians. This is the first report of a vaccine that protects reptiles against viral infection.

Biological sciences/Microbiology/Virology/West nile virus

Biological sciences/Microbiology/Vaccines/Live attenuated vaccines

West Nile virus

Binjari virus

saltwater crocodiles

pix

chimeric vaccine

neutralising antibodies

vaccine safety

vaccine efficacy

West Nile virus (WNV), including the Australian Kunjin strain (WNV_KUN), is a mosquito-borne zoonotic virus of global health concern and has been responsible for several outbreaks in a range of species, including birds, horses, humans, and reptiles. The virus transmission cycle is maintained between birds and mosquitoes, primarily mosquitoes of the Culex spp. ^1–5. However, additional modes of transmission, such as fecal-oral transmission, have been reported in crocodilians ^6–8.

Infected mammals and birds generally develop a subclinical disease characterised by non-specific fever ⁹. A small proportion of infected individuals amongst humans, sheep, horses, birds, and alligators develop a severe meningoencephalitis syndrome ^10–14. The clinical picture in crocodilians varies widely from subclinical infection in saltwater crocodiles ¹⁵ to severe disease in American alligators (Alligator mississippiensis) characterised by neurological and digestive tract syndromes ⁸. They also develop skin lesions known as "pix" ^8,16. While infected saltwater crocodiles (Crocodylus porosus) do not exhibit overt clinical disease, they do develop "pix" skin lesions that cause depreciation and rejection of the hides from farmed animals during their processing for leather ¹⁵. Hide rejections result in large economic losses which threaten industry viability and the sustainable use conservation program that employs indigenous Australians and has returned this apex predator from the brink of extinction ¹⁷. Infected saltwater crocodiles and alligators can also develop viraemic titres sufficiently high to sustain a transmission cycle with feeding mosquitoes ^6,7. Given this potential role as an amplifying host, protecting farmed saltwater crocodiles from WNV infection would not only reduce industry losses but also serve, by extension to protect humans and other animal hosts.

Currently, there are four WNV vaccines approved for veterinary use in the USA for horses. Most of these vaccines must be administered biannually to be fully protective ¹⁸. One inactivated vaccine (West Nile Virus Vaccine, Boehringer Ingelheim Vetmedica, Inc. [BIVI], St. Joseph, MO), commercially available for use in horses, has been used off-label in alligators ^18,19. A subsequent report questioned vaccine safety since WNV viral genomic material was detected in tissue samples from vaccinated alligators. However, it is not yet clear at this stage whether the detected viral RNA was from the vaccine rather than a natural infection ²⁰. Regardless, none of these vaccines are licensed and available in Australia, hence there is a need for a vaccine for use in farmed saltwater crocodiles, an important industry in Northern Australia.

In the quest for reliable and safe vaccine candidates against pathogenic flaviviruses, a new chimeric vaccine platform was developed based on an insect-specific flavivirus (ISF) ²¹. The platform consists of exchanging the structural proteins prM and envelope (E) of a newly discovered ISF, known as Binjari virus (BinJV) with those of pathogenic flaviviruses ²¹. The resulting chimeric virions are structurally and antigenically similar to parental pathogenic flaviviruses but retain the ISF phenotype and cannot replicate in vertebrate cells, rendering them safe vaccine candidates in vertebrates ^21,22. Herein we report on our investigations of the efficacy of BinJV/WNV as a novel vaccine candidate to protect saltwater crocodiles from WNV infection and the development of pix lesions.

Since there are currently no commercial WNV-vaccines available in Australia, we investigated the immunogenicity and safety of two chimeric vaccines candidates in saltwater crocodile hatchlings devoid of maternal antibodies. BinJV/WNV_KUNproto contains the prM-E sequence from the 1960 prototype isolate of WNV_KUN while BinJV/WNV_KUN2011contains the prM-E sequence from a 2011 isolate of WNV_KUN.

Vaccine immunogenicity

Groups of 70 crocodile hatchlings were immunised subcutaneously (SC) or intramuscularly (IM), with two doses of each vaccine candidate as per Table 2 and 20% of animals in each group were sampled at timepoints indicated in Figure 1A.

By four weeks after the first vaccination (pre-booster in Figure 1 B and C), only 14 to 35% (2/14 - 5/14) of crocodiles in each vaccination group had developed detectable neutralising antibodies. The maximum titres ranged from 20 to160. However, by 4-8 weeks post-booster (8-12 weeks post prime vaccination), most (79 - 100 %) of the animals in each vaccination group had seroconverted. The median neutralising antibody titre for the vaccinated groups ranged from 10 to 120, (with individual titres ranging from <20 to 640) (Table 1, Supplementary Table 8). Notably, the neutralising titres had risen by 7 months post vaccination in all groups with median neutralising antibody titres ranging from 80 to 1280 (individual range of <20 – ≥2560) (Table 1, Supplementary Table 9), suggesting a relatively delayed peak of neutralising antibody response in crocodiles (Figure 1B, C). While there was no statistically significant difference between various groups vaccinated with BinJV/WNV_KUN2011 at any time point (Figure 1C), there were differences between some of the BinJV/WNV_KUNproto groups. The neutralising titres were statistically different at 12 weeks (*p=0.0179) and seven months post vaccination (**p=0.0074) between groups receiving 2 µg SC and 2 µg IM of BinJV/WNV_KUNproto, and between the 2 µg IM and 10 µg SC groups (***p=0.0007) 12 weeks post vaccination (8 weeks post-booster) with the same vaccine (Figure 1B). There was no statistically significant difference in neutralising antibody titres between groups after the first vaccination with BinJV/WNV_KUNproto or BinJV/WNV_KUN2011 (4 weeks post prime) or at eight weeks post booster (12 weeks post prime) irrespective of vaccine dose and route of administration (p≤0.5), although slightly lower titres were observed at these time points in animals that received BinJV/WNV_KUN_proto by IM route (Supplementary Figure 3 and Tables 1). By 7 months post vaccination, neutralising antibody titres also tended to be lower in groups having received BinJV/WNV_KUN_proto, with titres statistically lower for 2 µg of BinJV/WNV_KUNproto administered via IM route (titre of 80) compared to 2 µg of BinJV/WNV_KUN2011 by the same route (titre of 640) (*p= 0.0348) or compared to 10 µg of BinJV/WNV_KUN2011 administered through subcutaneous route (titre of 1280) (**p= 0.0057). Neither BinJV/WNV_KUN2011 nor BinJV/WNV_KUNproto caused any noticeable side effects in vaccinated crocodiles irrespective of vaccine dosage, route of administration, or type of vaccine.

Vaccine safety: no evidence of BinJV/WNV_KUN replication in crocodiles

To confirm that the insect-specific host-restriction of the vaccine candidates extended to crocodilian species in vivo, we investigated whether the BinJV/WNV chimeric viruses could replicate in vaccinated crocodiles. All BinJV NS5 and NS3 specific RT-PCR and qRT-PCR on plasma and cloacal swabs from vaccinated crocodiles and pen water samples were negative. The lack of detectable viral RNA in all tested samples using these sensitive assays suggested that the chimeric viruses did not replicate, or that replication was below the limit of detection, in crocodiles vaccinated with BinJV/WNV_KUN (Supplementary Figure 1). This finding corroborates the inability of the chimeric vaccine to replicate in saltwater crocodile-derived cell lines ²¹.

WNV_KUN challenge of crocodiles vaccinated with BinJV/WNV_KUN

The BinJV/WNV_KUN2011 vaccine was selected for use in a subsequent challenge study to test for protection efficacy against WNV infection and skin lesions. This selection was based on its slightly better performance in the immunogenicity study above, the higher yields it gave in production ²¹ and our previous findings that all WNV_KUN RNA detected in lesions of naturally infected crocodiles was genetically more similar to WNV_KUN2011. The selected chimeric vaccine is henceforth referred to simply as BinJV/WNV_KUN for clarity.

This experiment used a 10 µg dose of vaccine formulated with or without an adjuvant (Advax™). We also assessed the effect of UV-C inactivation of the vaccine on immunogenicity and efficacy to address the possibility that low but undetectable levels of replication of the vaccine in crocodiles enhanced the immune response.

As observed in the immunogenicity study above, low levels of neutralising antibodies (titres of 20 - 40) were first detected at four weeks post prime immunisation in a few crocodiles in all treatment groups, with the exception of the non-adjuvanted inactivated vaccine group (Supplementary Figure 4). By eight weeks post prime vaccination (pre-challenge), all animals (100%, n=25) vaccinated with live adjuvanted BinJV/WNV_KUN had neutralising antibodies while 23 of 25 (92%) animals vaccinated with live non-adjuvanted vaccine had neutralising antibodies. At the same timepoint, 24 of 25 (96%) animals immunised with inactivated adjuvanted BinJV/WNV_KUN had neutralising antibodies while 18 of 25 (72%) animals vaccinated with inactivated non-adjuvanted BinJV/WNV_KUN had neutralising antibodies. The median neutralising antibody titre at pre-challenge sampling was 160 (range < 40 - ≥2560) for the live adjuvanted vaccine, 80 (range < 20 - 1280) for the live non-adjuvanted, 40 (range < 20 - 640) for the inactivated adjuvanted vaccine and 20 (range < 20 - 320) for inactivated non-adjuvanted vaccine (Figure 1C and Supplementary Figure 4). While there was an apparent trend of enhanced immunogenicity between vaccination groups (live-adjuvanted > live-unadjuvanted > inactivated adjuvanted > inactivated unadjuvanted), virus neutralising antibody titres were not statistically different between treatment groups at four weeks post prime vaccination (pre-booster) or four weeks post booster (pre challenge) (Supplementary Figure 4).

BinJV/WNV_KUN vaccine protects crocodiles against viraemia and development of "pix" lesions

None of the vaccinated animals from the four vaccine groups were viraemic as assessed by qRT-PCR four days post-challenge while 4 of 10 randomly selected animals from the mock vaccinated group tested positive for WNV_KUN by qRT-PCR (Supplementary Table 4). Twenty-one days post challenge, 23 of 27 (85.2%) animals from the mock-vaccinated group had developed neutralising antibodies confirming a productive infection in most animals after virus challenge.

None of the vaccinated crocodiles developed "pix" skin lesions. In contrast, six of 27 (22%) of the mock-vaccinated crocodiles developed skin lesions characteristic of WNV infection (Figure 2C). Four of these animals (14.8%) had one or more lesions confirmed to be positive for WNV through detection of viral RNA by qRT-PCR. The average viral RNA load per "pix" lesion by qRT-PCR was 10⁴ TCID₅₀ equivalent (Figure 2D).

BinJV/WNV_KUN vaccination prevents viral shedding into water

Our previous research demonstrated that infected saltwater crocodiles shed virus into water resulting in faecal-oral transmission of WNV to tankmate crocodiles ⁷. Water samples, as well as cloacal swabs from unvaccinated pen mates (n=5 per group), were collected and tested by qRT-PCR to investigate if the BinJV/WNV_KUN vaccine prevented virus shedding by vaccinated crocodiles challenged with WNV_KUN. None of the samples collected from vaccinated animals or their unvaccinated pen mates yielded detectable viral genomic signals by qRT-PCR. In contrast, four cloacal swab samples out of 27 (14.8%) collected from the mock vaccinated group 14 days post-challenge were positive by qRT-PCR as were the water samples collected from this group on days 10 and 13 post-challenge by qRT-PCR (Supplementary Table 6). Water samples from all vaccinated groups were negative at all sampling time points (Supplementary Table 6).

Mosquito surveillance throughout the vaccine trials

All FTA cards were negative for WNV_KUN by qRT-PCR, and no mosquitoes were caught within or around the experimental facilities during the experiments. These findings confirm that there were few mosquitoes in the environment and that no natural mosquito-borne viral transmission was detected during the studies.

West Nile virus is an economic threat to the crocodile farming industry due to the skin lesions (pix) caused by the virus. Although there are WNV vaccines for veterinary use in equines, and one is used off-label in alligators in the USA, there are no published reports of the vaccine efficacy in American alligators. Currently, there is no vaccine available for crocodilians in Australia, South-East Asia, and Africa, where the risk of new WNV outbreaks remains imminent and significant. Here, we demonstrate that the BinJV/WNV_KUN vaccine induces a robust, humoral immune response after two vaccinations administered subcutaneously or intramuscularly at four weeks interval. We also demonstrate that the BinJV/WNV_KUN vaccine offers complete protection from infection and skin lesions in challenged saltwater crocodiles.

The efficacy of BinJV-based chimeric vaccines in the prevention of flavivirus infections has previously been demonstrated in various mouse models ^21–24. Here we demonstrate for the first time in a non-murine species the efficacy and safety of BinJV/WNV_KUN as a vaccine to prevent infection and WNV-induced skin lesions in farmed saltwater crocodiles.

The immune response in reptiles, i.e. cold-blooded animals, is generally slower to develop than in mammalian and avian species ²⁵. This may explain the late increase in antibody titre, beyond 8 weeks post booster immunisation with BinJV/WNV_KUN in the on-farm vaccine immunogenicity study. Another alternative explanation, that a boost to the immune response prior to the six-months blood-sampling may have occurred via natural exposure to WNV_KUN, is unlikely since no mosquito activity or WNV transmission was detected around the experimental area during the course of the trial - conducted during the tropical dry season. Furthermore, there was no evidence of natural infection as the animals remained negative in the WNV_KUN NS1 blocking-ELISA (Supplementary Table 7) and mock-vaccinated crocodiles had no neutralising antibodies at these time points. Hence, a more gradual, immune maturation is the most likely cause for the lengthier titre rise in these animals.

The route of administration and dose of BinJV/WNV_KUN did not appear to result in a statistically significant difference in the neutralising antibody response within the dose range tested. This provides more options to the vaccinator for selecting the dosage and the most convenient route of administration of the vaccine under a particular set of farm management conditions.

While the live vaccine induced slightly higher median VNT titres than the inactivated form and seroconversion was detected in more animals, the differences were not statistically significant (Supplementary Fig. 4). The addition of Advax™ adjuvant to both the live and inactivated vaccine formulations increased the median VNT titres however, again the differences were not statistically significant (Fig. 2B). Advax™ is a GMP-grade delta-inulin polysaccharide-based adjuvant that has been proven to be highly potent ^26,27. It has been demonstrated that Advax™ enhances the cellular immune response, mainly T-cell responses and B-cell memory when co-administered with an immunogen of interest ^28–31. This study did not assess the cellular immune response following vaccination with BinJV/WNV_KUN, therefore, it would be interesting to investigate that component of the immune response, particularly looking at the potential mid- to long-term protection associated with immunological memory in both humoral and cellular immune responses ³². Nevertheless, we observed full protection against "pix" skin lesions irrespective of whether the vaccine was inactivated or live or formulated with adjuvant or not when animals were challenged with virus four weeks post booster vaccination. These results are consistent with findings from our previous studies with this vaccine in mice ²².

No residual BinJV/WNV_KUN vaccine was detected in the blood of vaccinated animals two weeks post vaccination. This is in contrast to reports that a commercially available inactivated equine vaccine (West Nile Virus Vaccine, Boehringer Ingelheim Vetmedica, Inc. [BIVI], St. Joseph, MO) used off-label in American alligators, remained detectable for weeks after the vaccination raising some safety concerns ²⁰.

Since, for ethical reasons, we were only able to bleed the animals every three days in the vaccination-challenge study, we may by chance have missed detecting viraemia in some crocodiles in the unvaccinated control group at 2 days post challenge. Alternatively, the virus titres might have been below the limit of detection at that time point. Similarly, the 40% of animals with detectable viraemia at 4 days post challenge may only represent the minimum frequency of viraemia in unvaccinated animals. We have previously demonstrated that viraemia is brief in most crocodiles ⁷, therefore, a snapshot sampling does not necessarily represent the full extent of viraemia in infected animals. Notably, some apparently non-viraemic crocodiles from the control group developed typical pix skin lesions, supporting the contention of more widespread systemic infection than detected in the selective blood sampling and testing.

Only 14.8% of the cloacal swabs collected from the unvaccinated control group 14 days post challenge tested positive to WNV by qRT-PCR. This proportion is also likely to be lower than the actual number of crocodile shedding virus into water. We previously demonstrated that infected animals start shedding the virus between days 3- and 21 post-infection and shedding can be intermittent in a single host ⁷. Therefore, we hypothesise that earlier sampling could have resulted in a higher proportion of positive swabs in unvaccinated animals. Nevertheless, the fact that non-vaccinated, non-challenged pen-mates of the vaccinated and challenged animals did not seroconvert or become viraemic during the trial attests to the efficacy of the chimeric vaccine conferring sterilizing immunity in hatchling crocodiles. This finding was further supported by the absence of challenge virus in the water samples from pen holding vaccinated animals.

This is the first study to demonstrate the efficacy and safety of the BinJV/WNV_KUN chimeric vaccine candidate in a species other than mice. The study also provides the first documented evidence of a vaccine that protects crocodilians against viraemia, fecal virus shedding and "pix" skin lesions caused by WNV infection. In addition to its efficacy, BinJV/WNV_KUN was also confirmed not to replicate to detectable levels in vaccinated crocodiles consistent with our previous published reports that these chimeric vaccines do not replicate in vertebrate cells ^21,33. Therefore, BinJV/WNV_KUN provides an excellent vaccine platform for use in farmed crocodiles as it does not pose public health or environmental risks ^7,34. The vaccine also represents a promising WNV vaccine for other farmed crocodilians, including American alligators, and Nile crocodiles (Crocodylus niloticus).

Ethical consideration

This study was conducted in accordance with the University of Queensland research ethical guidelines. Ethical approval for the studies was obtained from the University of Queensland's Native and Exotic Wildlife and Marine Animal Ethics Committee (SCMB/028/17, SCMB/551/18, SCMB/515/19). During vaccination and sample collection, animal care and use protocols adhered to the Animal Welfare Regulations 2000 of the Northern Territory of Australia, The Code of Practise on the Humane Treatment of Wild and Farmed Australian Crocodiles, and the Australian Code for the Care and Use of Animals for Scientific Purposes. Further, the Centre for Crocodile Research operates under research licence 061 from the Northern Territory Government’s Department of Industry, Tourism and Trade and the Office of the Gene Technology Regulator (OGTR), Australia (Approval # DIR-159).

Chimeric viruses as vaccine candidates

Chimeric vaccine candidates comprising the genome backbone of the insect-specific BinJV and genes for the structural pre-membrane and envelope (prM-E) proteins of the Kunjin strain of West Nile virus (WNV_KUN) were generated by circular polymerase extension reaction as described previously ²¹. These chimeric viruses either contained the sequence for prM-E from a 2011 isolate ³⁵ (designated BinJV/WNV_KUN2011) or contained the prM-E sequence from the 1960 prototype isolate ³⁶ (designated as BinJV/WNV_KUNproto). These two viruses were assessed for safety and immunogenicity in crocodiles. Vaccine doses, routes of administration, number of immunisations and number of vaccinated animals per treatment group are summarised in Tables 2 and 3.

Animals and experimental design

Saltwater crocodile hatchlings, from different clutches were screened for maternal antibodies against WNV at four months of age both in blocking ELISA using anti-WNV NS1 specific 3.1112G monoclonal antibody and in virus neutralization test (VNT), as previously described ^7,37. Hatchlings free from maternal antibodies against WNV were housed in BSL2 and OGTR approved facilities in a mosquito-free environment. The crocodile hatchlings were randomly assigned to different treatment groups based on clutch of origin, vaccine type and regimen. We first assessed the immunogenicity and safety of BinJV/WNV_KUNproto and BinJV/WNV_KUN2011 (Table 2) and then investigated the efficacy of BinJV/WNV_KUN2011 in a challenge study (Table 3).

Vaccine preparation

For vaccine preparation, confluent C6/36 cell monolayers, grown in stationary T175 culture flasks (Greiner BioOne GmbH, Germany) in RPMI medium containing 2% fetal bovine serum, were infected with virus at a multiplicity of infection (MOI) of 0.1 and incubated at 28^oC. The virus supernatant was collected at 5dpi, clarified by centrifuging at 3,000 rpm 4^oC for 30 min, and stored at 4^oC until purification. The infected cell monolayers were replenished with fresh medium, and the harvesting process was repeated every 48-72 hours for a maximum of five harvests.

Vaccine purification

Polyethylene glycol 8,000 (PEG 8,000; Sigma-Aldrich, USA) w/v in NTE buffer [10mM Tris, 1 mM EDTA and 120 mM NaCl; pH 8.0]) was added to the virus supernatant 1:4 (v:v) and stirred slowly overnight at 4^oC. The mixture was then centrifuged at 8,000 rpm for 90 min at 4^oC (Beckman-Coulter JLA10.500 rotor) to pellet the virus. Following this, a sucrose cushion (20% sucrose in NTE, w/v) was layered under the resuspended pellet and the preparation centrifuged at 28,000 rpm (Beckman-Coulter, SW32Ti rotor) for 2 hours at 4^oC. The sucrose and supernatant were discarded, and the virus precipitate was soaked in NTE overnight at 4^oC. The following day, the pellet was carefully resuspended and layered onto a 25-40% potassium tartrate gradient in open-top thin-walled ultra-clear centrifuge tubes (11x60mm, Beckman-Coulter) and centrifuged at 50,000 rpm (Beckman-Coulter, SW60Ti rotor) for 1 hour at 4^oC. The virus bands were collected, and the purified virus buffer exchanged into sterile PBS using 30 kDa Amicon Ultra-15 centrifugal filter units (Merck) followed by storage at 4^oC until required. Purified virions were quantified with respect to envelope protein content against BSA standards by SDS-PAGE, Sypro Ruby staining (Invitrogen™) and ImageJ analysis ²².

Vaccine inactivation

Vaccine UV-inactivation was performed as previously described ²². Briefly, vaccine stock was diluted in sterile 1x PBS (pH 7.4) to the working stock (10 µg in 100 µL). In a 24-well plate, 250µL of the vaccine was aliquoted into each well, and the plates were placed on ice in a biosafety cabinet. With the lid off the plate, the vaccine was exposed to UV-C light for 90 minutes. The inactivated vaccine was titrated by the TCID₅₀ method on C6/36 cells to ensure the efficacy of UV-C inactivation. The vaccine inactivation was confirmed when the titre was below the limit of detection by TCID₅₀assay (2.30 log₁₀ TCID₅₀/ml), indicating the vaccine was at least 99.99% inactivated. Both live and inactivated vaccines were stored at 4^oC until they were used.

Immunogenicity and safety study with BinJV/WNV_KUN chimeric vaccine candidates

Four-month-old crocodile hatchlings, free of anti-WNV maternal antibodies, were immunised with each vaccine candidate either subcutaneously (SC) or intramuscularly (IM) (Table 2) in order to test their immunogenicity and safety. A subset (20% of animals in each group) of vaccinated and mock vaccinated animals were blood sampled at timepoints indicated in Figure 1A, and tested for the residual BinJV/WNV vaccine as per OGTR requirements. Blood plasma was heat-inactivated and tested in VNT for seroconversion to WNV antigens as previously described ²². Animals were monitored daily for any potential vaccine related adverse effects. Pen water samples were collected and tested for the presence of BinJV/WNV_KUN viral genome.

Vaccination with BinJV/WNV_KUN and WNV_KUN challenge study

After the immunogenicity and safety study, a challenge study was conducted where four months old crocodile hatchlings, determined to be free of anti-WNV maternal antibodies were allocated to five treatment groups. Two groups were vaccinated with 10 µg of purified live BinJV/WNV_KUN with or without 1 mg Advax™ adjuvant (Vaxine Pty Ltd., Adelaide, SA), while two other groups were immunised with 10µg purified UV-inactivated BinJV/WNV_KUN with or without 1 mg Advax™ adjuvant. The control group received placebo (PBS). All vaccine formulations were administered twice, four weeks apart, intramuscularly in a total volume of 120 µL (Table 3). Twelve weeks post initial vaccination (four weeks post booster vaccination) all animals were subcutaneously challenged with 1 x 10⁵ infectious units of WNV_Kun (NSW 2011 strain JN887352) as described ⁷.

Blood and cloacal swab samples were collected 14 days post booster vaccination to test for residual vaccine in vaccinated crocodiles or evidence of chimeric vaccine replication. Water samples were also collected daily from each treatment tank to assess for potential vaccine shedding into water. Five animals in each pen of the vaccine groups were left unvaccinated and unchallenged. These animals served as tank mate controls to determine if vaccinated animals would still shed the challenge virus into the pen water and transmit it to unvaccinated crocodiles via the fecal-oral route as previously demonstrated for unvaccinated animals ⁷. Following vaccination and challenge, animals were monitored daily for occurrence of adverse reactions post-vaccination, or development of clinical signs following the virus challenge. Experimental animals were blood sampled on the day of vaccination (day zero, baseline sampling), four weeks (i.e., at the time of booster vaccination), eight weeks (four weeks post booster vaccination and time of virus challenge), and finally 13 weeks post initial vaccination and 5 weeks post-challenge (Figure 2A).

At two- and four-days post-challenge, blood samples were collected from 10 (40%) randomly selected animals from each treatment group. These samples were tested for viral RNA in blood (viraemia) by qRT-PCR. Cloacal swab samples were collected at day 0 and 14 post-challenge and similarly tested by qRT-PCR. Five weeks post challenge animals from all treatment groups including mock vaccinated group were blood sampled and examined for the presence of "pix" skin lesions. Mock vaccinated were euthanised and cloacal swab samples were collected. After euthanasia, a systematic post-mortem examination was performed including collecting skin samples with and without "pix" lesions for viral genome investigation by WNV_KUN qRT-PCR. Crocodile skin was examined as previously described ¹⁵.

CO₂-baited mosquito traps (SMACK traps) ³⁸ equipped with honey baited nucleic acid preservation cards (FTA^TM cards) were installed around the experimental area to monitor for the baseline of natural mosquito transmission of WNV_KUN and other arboviruses for the duration of the trial ^39,40. The FTA card surveillance was conducted within the PC2 facility for the vaccine challenge study. For the on-farm vaccinations, the traps were set near the crocodile pens and other strategic sites on the farm.

RNA extraction

Viral RNA was extracted from plasma and swab samples using the Machery-Nagel Viral RNA Isolation kit (Dueren, Germany) as per manufacturer’s instructions. Total RNA from skin tissue samples, was isolated using the RNeasy Plus Kit (Qiagen, Inc.). Viral RNA from water was isolated using RNeasy PowerWater Kit (Qiagen, Inc.) in accordance with manufacturer instructions. RNA was extracted from FTA cards using TRIzol Reagent (Life Technologies) as previously described ⁴¹.

WNV RNA quantitation (qRT-PCR) in challenged animals

Viral genome load quantitation was achieved by quantitative reverse-transcriptase PCR (qRT-PCR) using QIAGEN's real-time PCR cycler, the Rotor-Gene Q (Qiagen, Inc.). Invitrogen™ SuperScript™ III Platinum™ Taq One-Step qRT-PCR System Kit (Life Technologies Corporation, Carlsbad, USA) was used. The WNV genome quantitation in plasma samples was determined using a WNV_KUN RNA standard derived from a viral stock with known titre ⁷. For cloacal swabs and water, the assessment was dichotomic based on the presence (positive) or absence (negative) of viral RNA in tested samples.

The qRT-PCR reaction consisted of 15 µL of the optimised master mix and 5 µL of RNA template (Supplementary Table 1). The cycling conditions consisted of cDNA synthesis at 55°C for 5 minutes, PCR initial activation at 95^oC for 2 min, followed by 50 cycles of 95^oC for 3 seconds, and 60^oC for 30 seconds. For each run, three technical replicates for each sample, a positive control, a negative control, and a no template control were used. A positive sample was determined based on the CT value corresponding to the assay’s limit of detection as previously described ⁷. A sample was considered negative based on the absence of a qRT-PCR amplification signal or a CT value greater than the limit of detection (Supplementary Figure 2).

Investigation of presence of vaccine residues in plasma samples from vaccinated animals (one-step RT-PCR and two step qRT-PCR)

A one-step RT-PCR was used to test for BinJV/WNV_KUN vaccine in plasma samples from vaccinated animals, water, and cloacal swabs using Invitrogen™ SuperScript™ III Platinum™ Taq One-Step qRT-PCR System Kit (Life Technologies Corporation, Carlsbad, USA) and primers targeting BinJV NS5 (forward primer 5’ GCA AGA TGT ACG CCG ATG ACA CCG C 3’ and a reverse primer 5’ GCC ATG TCG TTT AGA TAG GTG AGA GC 3’) amplifying a 480 base pairs sequence. The RT-PCR reaction consisted of 10 µL of the master mix and 2.5 µL of the RNA template (Supplementary table 2). The PCR cycling conditions were one cycle at 45°C for 30 min, one cycle at 94°C for 2 minutes, 40 cycles at 94°C for 30 seconds, 45°C for 30 seconds, and 68°C for one minute and one cycle at 68°C for 10 minutes. PCR products were run on 2% agarose gel electrophoresis. The size of the amplicon was verified using Bioline HyperLadder™ 1kb (Meridian Bioscience, Australia).

The same samples were also tested with the two-step qRT-PCR using QuantiNova SYBR Green PCR Kit (Qiagen, Inc.) according to the manufacturer’s instructions (Supplementary Table 3). The first step consisted of making cDNA using qScript cDNA Synthesis Kit (Quantabio, QIAGEN Beverly, Inc., USA). The cDNA synthesis consisted of a 20 µL reaction containing 4 µL of 5x qScript reaction mix (containing a mix of oligo-dT and random primers), 1 µL 20x qScript reverse transcriptase, 4 µL of RNA template, and 1 µL RNAseOUT® (ThermoFisher, USA) and 10 µL of Nuclease-free water. The RT cycling conditions were one cycle at 22°C for 5 minutes, one cycle at 42°C for 30 minutes, and one cycle at 85°C for 5 minutes. The second step consisted of qPCR using forward primer 5’ ACTGACAGAACTTGGTGCTATG 3’ and reverse primer 5’ GCATACGCCTCTCTCCATTAAG 3’ targeting BinJV NS3. These primers yielded an amplicon of 103 base pairs. The cycling conditions were one cycle at 95°C for 2 minutes followed by 40 cycles at 95°C for 5 seconds and 60°C for 10 seconds. The melting curve analysis was done between 72°C and 95°C. A standard of known BinJV/WNV_KUN vaccine titre (by TCID₅₀) was assessed simultaneously as a standard in each qPCR assay. Positive, negative, and no-template controls were used for each qPCR run.

Statistical Analysis

Data analysis and generation of graphs were done using GraphPad Prism 9 (GraphPad Software, Inc., San Diego, CA, USA) for Windows (version 9.5.0 (730) 2022). Levels of neutralising antibodies in different treatment groups were statistically analysed using at two-way analysis of variance (ANOVA). The two-way ANOVA was performed for multiple comparison analysis with the α-level set at 0.05 with a Tukey's post-test.

Acknowledgements

We thank the crocodile farm management and staff for providing access to facilities, crocodile hatchlings and feed. This research was funded by the Cooperative Research Centre for Developing Northern Australia (CRC-DNA, 2018-20; S.R.I., J.H.P., R.A.H., and H.B.O.), The National Health and Medical Research Council (NHMRC) of Australia (grant no. 1146237. R.A.H., H.B.-O., and J.H.-P), the SVS Bequest Fund (H.B-O. and G.H.), and a donation from BIOHMPATHOLOGY. G.H. is a recipient of an Australian Postgraduate Scholarship Award (2018–2022), the Adam Gillespie Memorial Scholarship for Animal Husbandry, the IUCN-SSC Crocodile Specialist Group Fritz Huchzermeyer Veterinary Science Student Research Assistance Scheme (FHVS-SRAS), and Fred Z. Eager Award. J.H.-P. is supported by an Advance Queensland Industry Research Fellowship.

Author Contributions

Project oversight: H.B.O., S.I., J.H.-P., and R.A.H. Experimental design: G.H., H.B.O., S.I., J.H.-P. and R.A.H. Experiments: G.H., S.I., J.M., J.J.H, A.M.G.C., W.W.S., J.H.-P., and H.B.O. Writing, original draft preparation: G.H., H.B.O and R.A.H. Writing, review and editing: all authors.

Competing interests

Data included in this publication are based on a patent (WO/2018/176075) on which R.A.H., J.H.-P J.J.H., H.B.O., and A.M.G.C.. are inventors. S.I. is the proprietor of Centre for Crocodile Research (Noonamah, Northern Territory, Australia). The remaining authors declare no conflicts of interest.

Ronca, S. E., Ruff, J. C. & Murray, K. O. A 20-year historical review of West Nile virus since its initial emergence in North America: Has West Nile virus become a neglected tropical disease? PLoS Negl. Trop. Dis.15, e0009190 (2021). https://doi.org:10.1371/journal.pntd.0009190
Gray, T. J. & Webb, C. E. A review of the epidemiological and clinical aspects of West Nile virus. Int. J. Gen. Med.7, 193-203 (2014). https://doi.org:10.2147/ijgm.S59902
Petersen, L. R., Brault, A. C. & Nasci, R. S. West Nile virus: review of the literature. JAMA310, 308-315 (2013). https://doi.org:10.1001/jama.2013.8042
Colpitts, T. M., Conway, M. J., Montgomery, R. R. & Fikrig, E. West Nile Virus: biology, transmission, and human infection. Clin. Microbiol. Rev.25, 635-648 (2012). https://doi.org:10.1128/cmr.00045-12
Habarugira, G., Suen, W. W., Hobson-Peters, J., Hall, R. A. & Bielefeldt-Ohmann, H. West Nile Virus: An Update on Pathobiology, Epidemiology, Diagnostics, Control and "One Health" Implications. Pathogens9, 589 (2020). https://doi.org:10.3390/pathogens9070589
Byas, A. D. et al. American alligators are capable of West Nile virus amplification, mosquito infection and transmission. Virology568, 49-55 (2022). https://doi.org:10.1016/j.virol.2022.01.009
Habarugira, G. et al. Mosquito-Independent Transmission of West Nile virus in Farmed Saltwater Crocodiles (Crocodylus porosus). Viruses12, 198 (2020). https://doi.org:10.3390/v12020198
Klenk, K. et al. Alligators as West Nile virus amplifiers. Emerg Infect Dis10, 2150-2155 (2004). https://doi.org:10.3201/eid1012.040264
Hawkes, R. A., Pamplin, J., Boughton, C. R. & Naim, H. M. Arbovirus infections of humans in high-risk areas of south-eastern Australia: a continuing study. Med J Aust159, 159-162 (1993). https://doi.org:10.5694/j.1326-5377.1993.tb137778.x
Davis, L. E. et al. West Nile virus neuroinvasive disease. Ann. Neurol.60, 286-300 (2006). https://doi.org:10.1002/ana.20959
Debiasi, R. L. & Tyler, K. L. West Nile virus meningoencephalitis. Nat. Clin. Pract. Neurol.2, 264-275 (2006). https://doi.org:10.1038/ncpneuro0176
Huntington, M. K., Allison, J. & Nair, D. Emerging Vector-Borne Diseases. Am. Fam. Physician94, 551-557 (2016).
Rimoldi, G. et al. West Nile Virus Infection in Sheep. Vet Pathol54, 155-158 (2017). https://doi.org:10.1177/0300985816653796
Santini, M. et al. Severe West Nile Virus Neuroinvasive Disease: Clinical Characteristics, Short- and Long-Term Outcomes. Pathogens11, 52 (2022). https://doi.org:10.3390/pathogens11010052
Isberg, S. R. et al. First evidence of Kunjin strain of West Nile virus associated with saltwater crocodile (Crocodylus porosus) skin lesions. Aust Vet J97, 390-393 (2019). https://doi.org:10.1111/avj.12862
Jacobson, E. R. et al. West Nile virus infection in farmed American alligators (Alligator mississippiensis) in Florida. J Wildl Dis41, 96-106 (2005). https://doi.org:10.7589/0090-3558-41.1.96
Corey, B. et al. Commercial harvests of saltwater crocodile Crocodylus porosus eggs by Indigenous people in northern Australia: lessons for long-term viability and management. Oryx52, 697-708 (2018).
Ng, T. et al. Equine vaccine for West Nile virus. Dev. Biol. (Basel)114, 221-227 (2003).
Davidson, A. H. et al. Immunologic responses to West Nile virus in vaccinated and clinically affected horses. J Am Vet Med Assoc226, 240-245 (2005). https://doi.org:10.2460/javma.2005.226.240
Higbie, C. T., Nevarez, J. G., Roy, A. F. & Piero, F. D. Presence of West Nile Virus RNA in Tissues of American Alligators (Alligator mississippiensis) Vaccinated with a Killed West Nile Virus Vaccine. J Herpetol Med Surg27, 18-21 (2017).
Hobson-Peters, J. et al. A recombinant platform for flavivirus vaccines and diagnostics using chimeras of a new insect-specific virus. Sci. Transl. Med.11, eaax7888 (2019). https://doi.org:10.1126/scitranslmed.aax7888
Vet, L. J. et al. Protective Efficacy of a Chimeric Insect-Specific Flavivirus Vaccine against West Nile Virus. Vaccines (Basel)8, 258 (2020). https://doi.org:10.3390/vaccines8020258
Choo, J. J. Y. et al. A chimeric dengue virus vaccine candidate delivered by high density microarray patches protects against infection in mice. NPJ Vaccines6, 66 (2021). https://doi.org:10.1038/s41541-021-00328-1
Choo, J. J. Y. et al. Developing a Stabilizing Formulation of a Live Chimeric Dengue Virus Vaccine Dry Coated on a High-Density Microarray Patch. Vaccines9, 1301 (2021). https://doi.org:10.3390/vaccines9111301
Jacobson, E. R. Infectious diseases and pathology of reptiles: color atlas and text. 731 (CRC Press, 2007).
Petrovsky, N. & Cooper, P. D. Advax™, a novel microcrystalline polysaccharide particle engineered from delta inulin, provides robust adjuvant potency together with tolerability and safety. Vaccine33, 5920-5926 (2015). https://doi.org:10.1016/j.vaccine.2015.09.030
Li, L., Honda-Okubo, Y., Li, C., Sajkov, D. & Petrovsky, N. Delta Inulin Adjuvant Enhances Plasmablast Generation, Expression of Activation-Induced Cytidine Deaminase and B-Cell Affinity Maturation in Human Subjects Receiving Seasonal Influenza Vaccine. PLoS One10, e0132003 (2015). https://doi.org:10.1371/journal.pone.0132003
Abouie Mehrizi, A., Bagheri Verjani, S. & Zakeri, S. Advax, as a Co-adjuvant, in Combination with Poly(I:C) Elicits Enhanced Th1 Immune Responses and Parasite Growth-Inhibitory Antibodies Against Plasmodium Falciparum Merozoite Surface Protein-1 (PfMSP-142) in BALB/c Mice. Iran J. Immunol.18, 279-291 (2021). https://doi.org:10.22034/iji.2021.85629.1720
Bielefeldt-Ohmann, H. et al. Safety and immunogenicity of a delta inulin-adjuvanted inactivated Japanese encephalitis virus vaccine in pregnant mares and foals. Vet Res45, 130 (2014). https://doi.org:10.1186/s13567-014-0130-7
Hayashi, M. et al. Advax, a Delta Inulin Microparticle, Potentiates In-built Adjuvant Property of Co-administered Vaccines. EBioMedicine15, 127-136 (2017). https://doi.org:10.1016/j.ebiom.2016.11.015
Honda-Okubo, Y., Saade, F. & Petrovsky, N. Advax™, a polysaccharide adjuvant derived from delta inulin, provides improved influenza vaccine protection through broad-based enhancement of adaptive immune responses. Vaccine30, 5373-5381 (2012). https://doi.org:10.1016/j.vaccine.2012.06.021
Zimmerman, L. M. The reptilian perspective on vertebrate immunity: 10 years of progress. J Exp Biol223, jeb214171 (2020). https://doi.org:10.1242/jeb.214171
Harrison, J. J. et al. Antigenic Characterization of New Lineage II Insect-Specific Flaviviruses in Australian Mosquitoes and Identification of Host Restriction Factors. mSphere5, e00095-00020 (2020). https://doi.org:10.1128/mSphere.00095-20
Habarugira, G. et al. Evidence of Infection with Zoonotic Mosquito-Borne Flaviviruses in Saltwater Crocodiles (Crocodylus porosus) in Northern Australia. Viruses14, 1106 (2022). https://doi.org:10.3390/v14051106
Frost, M. J. et al. Characterization of virulent West Nile virus Kunjin strain, Australia, 2011. Emerg Infect Dis18, 792-800 (2012). https://doi.org:10.3201/eid1805.111720
Coia, G., Parker, M. D., Speight, G., Byrne, M. E. & Westaway, E. G. Nucleotide and complete amino acid sequences of Kunjin virus: definitive gene order and characteristics of the virus-specified proteins. J Gen Virol69 ( Pt 1), 1-21 (1988). https://doi.org:10.1099/0022-1317-69-1-1
Hall, R., Broom, A., Hartnett, A., Howard, M. & Mackenzie, J. Immunodominant epitopes on the NS1 protein of MVE and KUN viruses serve as targets for a blocking ELISA to detect virus-specific antibodies in sentinel animal serum. J. Virol. Methods51, 201-210 (1995). https://doi.org:10.1016/0166-0934(94)00105-p
Johnson, B. J. et al. Development and field evaluation of the sentinel mosquito arbovirus capture kit (SMACK). Parasit Vectors8, 509 (2015). https://doi.org:10.1186/s13071-015-1114-9
Hall-Mendelin, S. et al. FTA Cards Facilitate Storage, Shipment, and Detection of Arboviruses in Infected Aedes aegypti Collected in Adult Mosquito Traps. Am J Trop Med Hyg96, 1241-1243 (2017). https://doi.org:10.4269/ajtmh.16-0981
Kurucz, N. et al. Nucleic Acid Preservation Card Surveillance Is Effective for Monitoring Arbovirus Transmission on Crocodile Farms and Provides a One Health Benefit to Northern Australia. Viruses14 (2022). https://doi.org:10.3390/v14061342
Skonieczna, K. et al. RNA isolation from bloodstains collected on FTA cards - application in clinical and forensic genetics. Arch Med Sadowej Kryminol66, 244-254 (2016). https://doi.org:10.5114/amsik.2016.66706

Table 1. Comparison of median neutralising antibody titres induced by BinJV/WNV_KUNproto and BinJV/WNV_KUN2011

Timepoint (Post-prime)	2 μg SC		2 μg IM		10 μg SC		10 μg IM		Mock (PBS)
Timepoint (Post-prime)	B/WNV_KUNproto	B/WNV_KUN2011	B/WNV_KUNproto	B/WNV_KUN2011	B/WNV_KUNproto	B/WNV_KUN2011	B/WNV_KUNproto	B/WNV_KUN2011	Mock (PBS)
Pre-vaccination	< 20	< 20	< 20	< 20	< 20	< 20	< 20	< 20	< 20
4 weeks	< 20	< 20	< 20	< 20	< 20	< 20	< 20	< 20	< 20
8 weeks	40	40	30	80	80	80	80	120	< 20
12 weeks	40	40	10	40	80	80	60	80	< 20
7 months	640	640	80	640	240	1280	160	640	< 20

Table 2. Doses and routes of administration of vaccine candidates used in immunogenicity and safety study

Treatment group/Vaccine	Type	Dose	Route	Number of immunisations	Number of vaccinated animals
BinJV/WNV_KUNproto	Chimeric vaccine	10 µg	IM	2	70
		10 µg	SC	2	70
		2 µg	IM	2	70
		2 µg	SC	2	70
BinJV/WNV_KUN2011	Chimeric vaccine	10 µg	IM	2	70
		10 µg	SC	2	70
		2 µg	IM	2	70
		2 µg	SC	2	70
Mock vaccinated	PBS	-	IM	-	140

Table 3. Vaccine formulations used in the challenge study

Treatment group/Vaccine	Type	Dose	Route	Number of immunisations	Number of vaccinated animals	Unvaccinated pen mates
BinJV/WNV_KUN2011	Chimeric vaccine	10 µg live	IM	2	25	5
		10 µg inactivated	IM	2	25	5
		10 µg live adjuvanted	IM	2	25	5
		10 µg inactivated adjuvanted	IM	2	25	5
Mock vaccinated	PBS	-	IM	2	27	-

There is a conflict of interest Data included in this publication are based on a patent (WO/2018/176075) on which R.A.H., J.H.-P J.J.H., H.B.O., and A.M.G.C.. are inventors. S.I. is the proprietor of Centre for Crocodile Research (Noonamah, Northern Territory, Australia). The remaining authors declare no conflicts of interest.

Supplementarymaterial210223Final.docx

Download PDF

Journal Publication

published 27 Jun, 2023

Read the published version in npj Vaccines →

Editorial decision: revise
12 Apr, 2023
Review #4 received at journal
03 Apr, 2023
Review #3 received at journal
11 Mar, 2023
Review #1 received at journal
10 Mar, 2023
Review #2 received at journal
09 Mar, 2023
Reviewer #4 agreed at journal
08 Mar, 2023
Reviewer #3 agreed at journal
01 Mar, 2023
Reviewer #2 agreed at journal
01 Mar, 2023
Reviewer #1 agreed at journal
28 Feb, 2023
Reviewers invited by journal
28 Feb, 2023
Editor assigned by journal
23 Feb, 2023
Submission checks completed at journal
23 Feb, 2023
First submitted to journal
21 Feb, 2023

You are reading this latest preprint version

A chimeric vaccine protects saltwater crocodiles (Crocodylus porosus) from skin lesions caused by West Nile virus

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Conclusion

Materials And Methods

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1