Animals and in vivo treatment
To limit the potential gender differences, we selected only male rats. Young male Sprague-Dawley (220-250 g, Laboratory Animal Center of Sun Yat-sen University, Guangzhou, China) were studied 4 weeks after a single subcutaneously injection of MCT (60 mg/kg; Sigma, USA) or vehicle[18]. From the first day, MCT-injected rats were randomly divided into two groups. Rats from one group received daily intraperitoneal injection of celastrol (1mg/kg/day, TargetMol, Shanghai, China) for 4 weeks and vehicle [0.9% dimethylsulfoxide+2% Tween80+97.1% saline] in the same volume for another group. Rats were maintained on standard laboratory rat chow and water ad libitum and kept on a 12-h/12-h light–dark cycle.
Echocardiography
Rats were anesthetized with continuous isoflurane inhalation (1.5-3%) and kept with spontaneous respiration. Transthoracic echocardiography was performed by a 25 MHz linear array transducer (Vevo 2100, VisualSonics, Toronto, Canada). Short axis M-mode recordings were obtained to measure left ventricle ejection fraction (LVEF). The pulsed-wave doppler recording at the right ventricular overflow tract was used to measure pulmonary acceleration time (PAT), peak ejection time (PET) and pulmonary artery velocity time integral (PA-VTI). Tricuspid annular plane systolic excursion (TAPSE) was measured by using M-mode across the tricuspid valve annulus at the RV free wall. TAPSE was determined by measuring the excursion of the tricuspid annulus from its highest position to the peak descent during ventricular systole. Analyses were performed with observers blinded to the source of the images.
RV catheterization and hypertrophy index
After Echocardiography, terminal invasive hemodynamic measurements were performed to confirm RV pressure via RV catheterization. The rats were anaesthetized with pentobarbital sodium (40mg/kg)and fixed on plank, then the right jugular vein was isolated and freed for intubation. The PE-50 tube was filled with heparin saline, connected to a pressure sensor (Techman, Chengdu, China) and inserted into the right external jugular vein. The appearance of the ventricular pressure wave indicated that the catheter reached the RV. Then the RV pressure (RVP) was recorded and the systolic pressure (RVSP) was analyzed. After the RVSP was measured, the chest was quickly opened to harvest the heart and lungs of rats. The left and right atrium and blood vessels along the junction of the atrioventricular compartment were cut. Then the RV, left ventricle (LV) and interventricular septum (IVS) were separated and measured separately. The RV hypertrophy index was calculated as [RV/(LV + IVS)].
Masson staining and hematoxylin-eosin (H&E) staining
After hemodynamic measurements and blood withdrawals, heart and lungs were excised and harvested for fibrosis, morphometric and histologic analysis. The heart and middle lobe of the right lung were dissected and fixed in 4% paraformaldehyde for 24h, then embedded in paraffin and sectioned. Heart sections were stained with Masson’s trichrome and lung sections were stained with hematoxylin and eosin (H&E). A light microscope (Carl Zeiss, Jena, Germany) was used for overall histological assessment. The fibrosis of RV was assessed by Image-Pro Plus software (Version 6.0, Media Cybernetics, Silver Springs, MD, USA). Pulmonary arterial wall thickness (WT) was calculated by the following formula: WT (%) = areaext-areaint / areaext × 100, where areaext and areaint are areas bounded by external and internal elastic lamina, respectively.
Immunohistochemistry
Western Blot
Flash-frozen inferior lobe of right lungs were homogenized in radioimmunoprecipitation assay buffer supplemented with Halt protease and phosphatase inhibitor cocktail (Thermo Fisher scientific, Waltham, MA, USA). Protein content was determined by using a BCA protein assay (Thermo Fisher scientific, Waltham, MA, USA). Equivalent amount of protein was resolved by SDS–polyacrylamide gel electrophoresis (PAGE) (10%) and transferred to polyvinylidene difluoride membranes. After being blocked for 1 h in 5% nonfat dry milk and tris-buffered saline, the membrane was incubated with the desired primary antibody for 8 h in 4℃. The membrane was then treated with appropriate horseradish peroxidase conjugated secondary antibody (Cell Signaling Technology, Danvers, MA, USA), and the immuno-reactive bands were detected by chemiluminescence (ECL) reagents (Merck Millipore, Billerica, MA, USA). Specific antibodies for TGF-β1(sc-130348, Santa Cruz, CA, USA), IkBα (4814S, Cell Signaling Technology, Danvers, MA, USA), phosphorylated IKKα/β (2697S, Cell Signaling Technology, Danvers, MA, USA), p65(sc-8008, Santa Cruz, CA, USA), GAPDH (60004-1-lg, Proteintech, Chicago, IL, USA) were used in immunoblot assay. For analysis, the expression of target proteins was normalized to GAPDH.
Quantitative Real-time RCR
The superior lobe of right lungs, isolated from the rats, were homogenized and total RNA was purified with TRIzol reagent (Thermo Fisher scientific, Waltham, MA, USA) according to the manufacturer’s instructions. One thousand nanograms of RNA was reverse-transcribed to cDNA by using the PrimeScript™ RT reagent Kit (RR037A, kara, Tokyo, Japan). PCR primers were designed and synthesized by Invitrogen (Thermo Fisher scientific, Waltham, MA, USA). The following specific primers were generated and used: for Collagen I, forward primer: GTACATCAGCCCAAACCCCA, reverse primer: TCGCTTCCATACTCGAACTGG; for Collagen III, forward primer: TGGTGGCTTTCAGTTCAGCTA, reverse primer: ATTGCCATTGGCCTGATCCA; for TGF-β1, forward primer: CTGCTGACCCCCACTGATAC, reverse primer: AGCCCTGTATTCCGTCTCCT; for monocyte chemotactic protein 1 (MCP-1), forward primer: TGTCTCAGCCAGATGCAGTT, reverse primer: CAGCCGACTCATTGGGATCA; for IL-1β, forward primer: TAGCAGCTTTCGACAGTGAGG, reverse primer: CTCCACGGGCAAGACATAGG; for IL-6, forward primer: CATTCTGTCTCGAGCCCACC, reverse primer: GCTGGAAGTCTCTTGCGGAG; for IL-10, forward primer: CCTGGTAGAAGTGATGCCCC, reverse primer; GACACCTTTGTCTTGGAGCTTAT; for GAPDH, forward primer: CGCTAACATCAAATGGGGTG, reverse primer: CGCTAACATCAAATGGGGTG. Quantitative PCR was performed using TB Green® Premix Ex Taq™ II (RR820A, Takara, Tokyo, Japan) and assayed in duplicate, according to the manufacturer’s instructions in a BioRad CFX96 PCR system (Bio-Rad, Hercules, CA, USA). For analysis, the expression of target genes was normalized to GAPDH.
EdU proliferation assay
Cell proliferation was studied with EdU Cell Proliferation Assay Kit (EdU-488, Beyotime, Shanghai, China), according to the manufacturer’s protocol. 1.8×104 human pulmonary artery smooth cells (HPASMCs, purchased from Sciencell, Carlsbad, CA, USA) were seeded into 24-well plates peer well and cultured overnight. Then the medium was replaced and 0.5μΜ or 1.0μΜ celastrol was added to the medium, and HPASMCs were exposed to hypoxic (2% oxygen) or normoxia (21% oxygen) conditions at 37℃ for 36h. After that, 10μM EdU was added to the cells. At the end of the 4-hour incubation, the medium was removed, and the cells were fixed in 4% paraformaldehyde for 15min at room temperature. After the aspiration of the fixing solution, the cells were stained with the BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 488 and DAPI (nuclear stain). Then the results were visualized through a fluorescence microscope (Leica, Wetzlar, Germany). The results were quantified by using Image-Pro Plus software (Version 6.0, Media Cybernetics, Silver Springs, MD, USA).
Cell viability assay
Cell viability was assessed by using cell counting kit-8 (CCK-8, Beyotime, Shanghai, China). In brief, HPASMCs were seeded into 96-well plates at a concentration of 6×103 cells/well and cultured for 24h. Then the medium was replaced and 0.5μΜ or 1.0μΜ celastrol was added to the medium, and HPASMCs were exposed to hypoxic (2% oxygen) or normoxia (21% oxygen) conditions at 37℃ for 36h. After the exposure and the replacement of the medium, 10μL CCK-8 solution was added to each well and incubated at 37°C for another 3 h. Optical density value at a wavelength of 450 nm was determined by using a microplate reader (Thermo Fisher scientific, Waltham, MA, USA).
Statistical analyses
All data was presented as mean±SEM. All statistical analyses were performed by using GraphPad Prism software (Version 8, La Jolla, CA, USA). Comparisons among groups were assessed with one-way ANOVA followed by Tukey’s post hoc test. Differences were considered statistically significant if p<0.05.