2.1 Animals and feeding trial
Chinese Hu sheep is famous for their high fecundity and early sexual maturity with reached puberty at 120 days of age. In this study, twenty-seven-3-month-old Hu lambs (average body weight of (22.9 ± 1.3 kg) were housed in individual pens (1 m ×1.5 m) and randomly divided into three groups (n = 9). Lambs in control group were fed diets without GPE, while in TAN1 and TAN2 received diets contained 0.36% and 0.72% GPE. The GPE was purchased from the Shanghai Jiaoyuan Co. Ltd. (Shanghai China), and purity quotient of GPE was up to 95%,condensed tannin was 56.5%. The diets (Table 1) were formulated as diet pellets with 6 mm in diameter.
Table 1
Ingredient (% of DM) | Content | Nutrient levels (% of DM) | Content |
---|
Barley straw | 26.00 | Metabolizable energy(MJ·kg− 1) b) | 12.6 |
Corn | 45.25 | Crude protein | 16.30 |
Malt root | 8.00 | Neutral detergent fiber | 35.10 |
Concentratesa) | 20.75 | Phosphorus | 0.34 |
Total | 100.00 | Calcium | 0.65 |
a) The Concentrate is composed of soybean meal, cotton seed meal, corn gluten meal, secondary powder, powder, vitamin and mineral premix, and provided the mineral premix (mg) and vitamin(IU) per kg of diets: Fe,70; Zn,41; Cu,8; I,0.7; Mn,24; Se,0.3; Co,0.3; VA,2500; VE,23. |
b) Metabolizable energy was calculated. |
The entire experimental period lasted for 81 days with the adaptation period from D0 to D20 and normal commencing trial period from D21 to D80. All rams were fed thrice a day at 8:00, 14:00 and 19:00 under free food intake and with libitum access to fresh water and multi-mutrient blocks. The daily feed intake was calculated from D21 to D30 and D71 to D80. All rams were weighted at the D21 and D80.
The trial was performed at Minqin Zhongtian Sheep Industry Co., Ltd. (Minqin, China) from August to November.
This study was conducted in strict accordance with the recommendations from the Guide for the Animal Care and Use Committee of Lanzhou University.
No lamb was harmed during the feeding trial.
2.2 Sample collection
Peripheral blood samples were collected at D81 and centrifuged at 1000 g at 4°C for 30 min to isolated serum. All lambs except the heaviest and lightest in each group were humanely slaughtered by a licensed slaughter man as previously described at the Minqin Zhongtian Sheep Industry Co. Ltd[13]. Their body, testis, epididymis weight and testis volume was evaluated as previously described[13]. After that, tissues from left testis without tunica albuginea were collected and stored using nitrogen and 10% formalin, respectively.
2.3 RNA isolation and cDNA synthesis
Total RNA was isolated using TRIzol reagent in accordance with the manufacturer’s instruction. The RNA purity and integrity were detected by using NanoDrop 2000 spectrophotometer (Thermo Fisher, Waltham, USA) and formaldehyde denaturing gel electrophoresis. The total RNA (2.5 µg) with A260/280 ratio between 1.8 to 2.0 and A260/230 ratio higher than 2.0 was reverse-transcribed to cDNA by using Trans-Script one-step gDNA removal and cDNA synthesis super-mix kit (TransGen Biotech, Beijing, China) at 42°C for 15 min and 85°C for 5 s following the manufacturer's instructions. The cDNA was diluted 1:10 with nuclease-free water and used for quantitative gene expression.
2.4 Quantitative real-time PCR analysis
The relative expression levels of anti-oxidative related genes, proliferation related genes and steroidogenesis related genes (Table 2) were detected by using transStart tip green qPCR super-mix (TransGen Biotech, Beijing, China) with Bio-Rad CFX96 real-time system (Bio-Rad, CA, USA) according to the previously reported[13]. The gene-specific primers used are shown in Table 2. The relative expression value of the target genes was normalized to the expression levels of hypoxanthine phosphoribosy transfer 1 (HPRT1), ribosomal protein S18 (RPS18) and ribosomal protein lateral stalk subunit P2 (RPLP2). The mRNA levels were expressed as the relative fold change (2−ΔΔCq).
Table 2
Primers sequences for analysed by quantitative RT-PCR experiments
Gene | Primer sequence 5’-3’ |
---|
GPX3 XM_015096153.1 | F: ctggtcattctgggcttcc R: ctgctctttctccccgttc |
GSTA1 XM_012100854.2 | F: gaaaaagacgccaagctgac R: aggctagggtccagctcttc |
LHR NM_001278566.1 | F: aatggcggtcctcatcttca R: atacagaaacggattggcgc |
FSHR XM_015093783.1 | F: ccacaccaaaagccagtacc R: gctcaccttcatgtagctgc |
Cu-ZnSOD XM_004012626.3 | F: ggagacctgggcaatgtgaa R: cctccagcgtttccagtctt |
StAR NM_001009243.1 | F: cccagctgcgtggatttatc R: ctctccttcttccagccctc |
3βHSD XM_012183658.1 | F: gaatcggcatggttctgtcc R: ccgtagatgtacatgggcct |
P450scc NM_001093789.1 | F: cagggctccggaaagtttgt R: acggtacagttctggaggga |
P450arom XM_001123000.1 | F: gcatggcaagctctccttct R: caccacgtttctcggcaaaa |
PCNA XM_004014340.2 | F: ttggtgcagctaacccttcg R: gtccgcattatcttcagccct |
PPARγ XM_015093026.1 | F: acggcggcttctacaccgact R: tgccgcttgacccactcgt |
FADS2 XM_015103138.1 | F: acccattgagtacggcaaga R: gtacaaagggatgagcagcg |
ELVOL2 XM_015093202.1 | F: acagacctgctctttccctc R: tgtagcctccttcccaactg |
HPRT1 XM_015105023.2 | F: cgactggctcgagatgtgat R: tcacctgttgactggtcgtt |
RPS18 XM_004018745.3 | F:cactgaggacgaggtggaac R:ctgtgggcccgaatcttctt |
RPLP2 XM_004023349.4 | F:agcgccaaggacatcaaaaag R:tggccagcttgccgatac |
3βHSD = 3β-hydroxysteroid dehydrogenase; Cu-ZnSOD = copper-zinc superoxide dismutase; ELOVL2 = elongation of very long chain fatty acids protein 2; FADS2 = fatty acid desaturase 2; FSHR = follicle-stimulating hormone receptor; GPX3 = glutathione peroxidase 3; GSTA1 = glutathione S-transferase A1; HPRT1 = hypoxanthine phosphoribosyl transferase 1; LHR = luteinizing hormone receptor; P450scc = cholesterol side-chain cleavage enzyme, p450arom = cytochrome aromatase P450; PCNA = proliferating cell nuclear antigen; PPARγ = peroxisome proliferators-activated receptors γ; RPLP2 = ribosomal protein lateral stalk subunit P2; RPS18 = ribosomal protein S18; StAR = steroid acute regulatory protein. |
2.5 Western blotting analysis
Total protein was isolated from testis using IP cells lysis buffer. The protein concentrations were estimated by BCA. Approximately 30 µg total protein was separated by SDS-PAGE on a polyacrylamide gel and then transferred onto PVDF membranes with a pore size of 0.45 µm. Then, membranes were blocked 2 h at room temperature with 5% fat-free milk, and incubated with primary antibodies [1:200 for Zn-CuSOD (CUSABIO, Wuhan, Chian) and 3βHSD (Bioss, Beijing, China), 1:600 for FSHR, StAR (Bioss, Beijing, China) and PCNA (Abcam, Cambridge, UK), and 1:1000 for βActin (Abcam, Cambridge, UK)] overnight at 4°C. After that, membranes were washed 3 times with PBST, and incubated with HRP-conjugated goat anti-rabbit secondary antibody antibody (Abcam, Cambridge, UK) at a 1:5000 dilution for 2 h at room temperature. After incubated, the membranes were washed 3 times and images were captured by Bio-Rad chemiluminescent image systems (Bio-Rad, CA, USA) using beyoECL plus kit (Thermo Fisher, Waltham, USA).
2.6 Testosterone, estradiol and LH levels
LH in the blood serum was detecting using Sheep Luteinizing Hormone (LH) ELISA Kit (CUSABIO, Wuhan, China) with detection reange 2–75 mIU/mL, and intra-assay and inter-assay coefficient of variations (CVs) were both ≤ 15%, according to the instruction. Testosterone and estradiol were detected by using an automated chemiluminescent microparticle immunoassay with Architect 2nd generation testosterone kit and Architect estradiol assay kit on Architect i4000SR system (Abbott Park, USA) as we previously mentioned[13].
2.7 Lipid extraction and fatty acid analysis
Testis lipids were extracted from 0.5 g of tissue by homogenization in chloroform/methanol (2:1, v/v). Trans-methylation of these samples was performed using the Metcalf method [14]. Fatty acids methyl esters were separated and quantified by TRACE 1300 gas chromatograph (Thermo Fisher, Waltham, USA) equipped with a flame ionization detector and a 100 m × 0.25 mm × 0.25 µm (HP-88, Agilent Technologies) fused silica capillary column. Nitrogen was used as carrier gas and temperature programming was from 50°C to 175°C at 13°C/min, and held there for 27 min, and then temperature-programmed at 3°C/min to 215°C, and held there for 27 min. The injector and detector temperatures were set at 240°C. Peak identification was based on the elution profile of known FAME chromatographic standards (fatty acid methyl esters, C4-C24, Nuchek Prep, Elysian, MN, USA) and previously reported [15, 16]. Relative quantification was normalized with the sum of all the detected species and shown as a percentage of total species[17].
2.8 Biochemical assays
Testicular tissues were weighted and homogenized in ice-cold PBS to create a 1:10 suspension with repeated freezing and thawing. After centrifuged at 10000 g for 5 min at 4°C, the supernatants concentrations were determined using BCA method.
Total antioxidant capacity (T-AOC) assay kit, superoxide dismutase (SOD) assay kit, total cholesterol assay kit, total triglyceride assay kit and non-esterified free fatty acids (NEFAs) assay kit (Nanjing Jiancheng, Nanjing, China) were used to measuring T-AOC, SOD, cholesterol, triglyceride and NEFAs on Epoch Microplate Reader (Bio-Tek Instruments, Winooski, VT, USA) according to the manufacturer’s protocols.
The biochemical concentrations were normalized with total protein in testicular tissues suspension.
2.9 Testicular histology
Testicular histology was analysed as previously described [13]. Briefly, testicular tissues (5 mm×5 mm× 5 mm) were fixed, dehydrated and embedded. Then sectioned at 5 µm thicknesses, and stained with hematoxylin and eosin (H&E). Histological evaluation was performed by light microscopy and images were captured using the Scopeimage 9.0 software (Ningbo yongxin, Ningbo, China). Diameter of seminiferous tubules and the number of Sertoli cells were analysed. For each tissue, 6 to10 seminiferous tubules were elevated.
2.10 Statistical analysis
The experimental results were presented as the group mean ± standard error of mean. The data was evaluated with SPSS program, version 13.0 (SPSS, Chicago, USA). Normal parameters were analysed by One-sample Kolmogorov-Smirnov test. Homogeneity of variances were analysed by Leven’s test. Significant differences were analysed by one-way ANOVA and Welch (unequal variances). Multiple comparisons between groups were compared with LSD and Dunnett T3 (unequal variances). P values < 0.05 was considered statistically significant.