Sequence and cloning. The lentiSAMv2 and lentiMPH v2 plasmids (a gift from Feng Zhang Addgene #75112 and #89308) were used for CRISPR-Cas9 activation. We analyzed the promoter region of the rat th gene, 1000–1200 bp upstream of the transcription start site, searching for PAM regions. We obtained ~ 20 sequences that were evaluated using BLAST analysis to check for mismatched sites on the rat (Rattus Norvegicus) genome. In addition, the th promoter region was also assessed with E-CRISP, CRISPRESSO2, CHOPCHOP, and Benchling software to select the candidate sequences by specificity score, annotation score, efficiency score, mismatched score, and the number of hits. Finally, we chose 13 sgRNA candidates that were evaluated for mismatches using the BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The single-guide RNA (sgRNA) sequences used in this study are listed in Supplementary Table 1, and were cloned in the lentiSAM v2 vector, employing the Golden Gate protocol using BsmBI (Thermo Fisher Scientific cat. no. IVGN0136) for plasmid restriction, t4 PNK (NEB, cat.no. M0201) for oligo annealing and t7 ligase (NEB, cat.no. M0318) for cloning(27).
Cell culture. HEK293T/17 cells (ATCC CRL-11268) were maintained in DMEM High Glucose (Gibco, cat. no. 12800-017) and pyruvate supplemented with 10% fetal bovine serum (Gibco, cat. no. 16000-044) and 1% penicillin/streptomycin (Thermo Fisher Scientific cat. no. 15140122). Cells were passaged every other day at a ratio of 1:6 or 1:5 using Trypsin 1x (Sigma, cat. no. 59428C). The C6 rat glioblastoma cell line (ATCC CCL-107) was maintained in F12 DMEM (Gibco, cat. no. 12500-062) with L-glutamine and pyruvate supplemented with 10% fetal bovine serum (Gibco, cat. no. 16000-044) and 1% penicillin/streptomycin (Thermo Fisher Scientific, cat. no. 15140122). Cells were passaged every other day at a ratio of 1:6 or 1:5 using Trypsin 1x (Sigma, cat. no. 59428C). CTX-TNA2 cells, a primary astrocyte non-tumorigenic line obtained from rat cerebral cortex (ATCC CRL-2006), was maintained in high-glucose DMEM (Gibco, cat. no. 12800-017) with pyruvate supplemented with 10% fetal bovine serum (Gibco, cat. no. 16000-044) and 1% penicillin/streptomycin (Thermo Fisher Scientific, cat. no. 15140122). Cells were passaged every other day at a ratio of 1:6 or 1:5 using Trypsin 1x (Sigma, cat. no. 59428C).
Transfection of C6 cells. C6 cells were transfected with Lipofectamine 3000 (Thermo Fisher Scientific, cat.no. L3000-15) The SAM system with each sgRNA in on C6 cells seeded in 60 mm petri dishes; for each sequence we seeded the cells at ~ 40% confluence the day before and 0.5 µgrams of plasmid DNA was transfected overnight with 1.5 ml of medium without serum and the other day change with fresh F12 DMEM 10% FBS medium.
Lentivirus production and cell infection. One day before transfection, HEK293T cells were seeded at ~ 50% confluency in 100 mm Petri dishes. Cells were transfected the next day at ~ 70–80% confluence. For each petri dish, 3 µg of each of the following plasmids were transfected using 24 µL of Lipofectamine 3000 (Thermo Fisher Scientific, cat.no. L3000-15) and 24 µL of P3000 Enhancer (Thermo Fisher Scientific, cat.no. L3000-15): pMD2.G (Addgene 12259), pMDLg/pRRE (Addgene 12251) and pRSV-Rev (Addgene 12253). Cells were transfected with 8 mL of high-glucose DMEM (Gibco 12800-017) without fetal bovine serum, and 12 hrs after the transfection, the medium was changed for complete maintenance medium. The virus supernatant was harvested 48 h post-transfection and centrifuged at 1200 rpm to eliminate debris and dead cells. The virus supernatant was then aliquoted and stored at − 80°C. Different cell lines were infected at 0.3 viral tier on 1.5 ml volume of pseudolentivirus with the SAM system, and each sgRNA and incubated overnight; then, the medium was removed, and fresh medium was applied; after 48 hrs, cells were processed for RNA and protein extraction. Resistance curves for blasticidin S HCl (10 µg/ml, Thermo Fisher Scientific, cat.no. A1113903) and hygromycin B (300 µg/ml, Sigma cat.no. H3274) were constructed, and cells were selected by their resistance to antibiotics. After 24 hrs of infection, fresh media containing the antibiotics were applied, and cells were maintained under antibiotic selection.
RT-PCR. Cells were seeded in 60 mm plates and grown to 90% confluency before RT-PCR. Total RNA was extracted using the Trizol reagent (Invitrogen, cat. no. 15596026). RNA quantification and purity were confirmed by spectrophotometric analysis using the Nanodrop instrument (Thermo Fisher Scientific, cat. no. 13-400-525). DNAse I (Sigma, cat.no. AMPD1) was used to degrade DNA; cDNA was synthesized using M-MLV (Invitrogen, cat. no. 28025-013), dNTPs 100 mM (Invitrogen, cat. no. 10297-018), and oligo dT (T4 Oligo Oligo dT 18-mer).
RT-PCR was performed using Taq Polymerase Kappa (Sigma, cat.no. BK1004), dNTPs (Invitrogen, cat. no. 10297-018), UltraPure™ DNase/RNase Free Distilled Water (Invitrogen, cat. no. 10977015) and the following primers were used: for th (FW ‘GGAGAGCTCCTGCACTCC’ REV ‘GGCATAGTTCCTGAGCTTG’), for β-actin (FW ‘TCACGCACGATTTCCCTCTCAG’ REV ‘TGGCACCACACCTTCTACA’), for dCas9 (FW ‘GCACATACCACGATCTGCTG’ REV ‘CGCTTCAGCTGCTTCATCAC’) and for ms2 (FW ‘GGGATGTGACAGTGGCTCC’ REV ‘GGACCTCCACCTTGATGGTATAC’). (Sigma-Aldrich). We used the following temperatures for the PCR assasys: 94° for denaturation, 57°C for annealing, and 72° for the extension step.
Western Blot. Protein extraction from cells or tissue was performed using a lysis buffer that contained a protease inhibitor cocktail (Complete, Roche Diagnostics, cat. no. 04574834001). Total protein (25 µg) was loaded for each sample for separation by SDS–polyacrylamide gel electrophoresis (8%) and transferred onto nitrocellulose membranes (BioRad; cat. no. 1620115). Membranes were blocked with 5% non-fat milk diluted in Tris-buffered saline containing 0.1% Tween-20 (TBST) for one h and incubated in the presence of anti-Th (Abcam ab112 monoclonal anti-rabbit 1:1000), or anti-Th F-11 (sc-25269 monoclonal anti-mouse, 1:1000), or anti-Th Millipore ab152 (monoclonal anti-rabbit 1:1000), anti-Glial Fibrillary Acidic Protein (DAKO Z0334 polyclonal anti-rabbit 1:2000), anti-Beta-actin-peroxidase (Sigma A3854 monoclonal anti-mouse 1:25000). Proteins were revealed using secondary peroxidase-coupled anti-rabbit and anti-mouse antibodies (Jackson ImmunoResearch), using the Western Lightning Plus-ECL Kit (PerkinElmer; Waltham, MA). Images were digitally captured using the FUSION SOLO S instrument (Vilbert Smart imagining). Autoradiograms were analyzed by densitometry using the Image J® software (NIH).
Immunofluorescence. C6 and astrocytes were seeded on coverslips, fixed with 4% paraformaldehyde and/or cold methanol, washed twice with PBS, and incubated using 0.2% Triton X-100/PBS/1% BSA for 30 min at room temperature. Cells were incubated using a primary mouse monoclonal antibody against anti-Th (Abcam ab112 monoclonal anti-rabbit) in C6 cells and anti-Glial Fibrillary Acidic Protein (DAKO Z0334 polyclonal anti-rabbit) and anti-Th F-11 (sc-25269 monoclonal anti-mouse) in astrocytes for 12 h. Coverslips were washed with 0.2% Triton X-100/PBS and incubated using the appropriate secondary antibodies, Alexa Fluor 594 donkey anti-mouse IgG (H + L) (Invitrogen A21203), and Alexa Fluor 488 donkey anti-rabbit IgG (H + L) (Invitrogen A21206.) Nuclei were counterstained using DAPI with Vectashield (Vector Laboratories).
Experimental subjects. Male Wistar rats weighing ~ 200 g were used for all experiments. Rats were housed on a 12-h light/dark cycle with free access to food and water at ~ 25˚C, with a relative humidity of 40 to 60%. All animal studies were performed according to the Guide for the Care and Use of Laboratory Animals (30), as adopted by the US National Institutes of Health and the Mexican Regulation of Animal Care and Maintenance (NOM-062-ZOO-1999). Rats were maintained and handled according to the guidelines of the CINVESTAV Animal Care Committee, making all efforts to minimize suffering and the number of animals used. The principles of the 3Rs (Replacement, Reduction, and Refinement) were followed to guarantee a humane endpoint.
Brain tissue immunofluorescence. Rats were euthanized ten weeks after the transplant of astrocytes or the sham treatment with an overdose of sodium pentobarbital (200 mg/kg i.p.) and transcardially perfused with saline followed by 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). Brains were dissected and post-fixed in PFA at 4°C for 24 h and then cryoprotected in 10% sucrose/PBS for 24 h, 20% sucrose/PBS for 24 h, and 30% sucrose/PBS for an additional 24 h at 4°C. Frozen coronal 35-µm-thick sections were cut in a sliding microtome (Leica Microsystems), collected in 2% PFA/PBS, and stored at four °C until processing.
Brain sections chosen for the analysis of the striatum were incubated in free-floating conditions in 0.2% Triton X-100/PBS for 30 min and blocked for 30 min in 1% BSA/0.2% Triton X-100/PBS at room temperature. Then, sections were incubated overnight with the primary rabbit antibody against the glial fibrillary acidic protein (Dako Z0334 polyclonal antirabbit GFAP, 1:500) and anti-Th (Sigma T1299 monoclonal anti-mouse, 1:200) diluted in 0.02% Triton X-100/0.1% BSA/PBS. For primary antibody detection, sections were rinsed with 0.02% Triton X-100/PBS and incubated for one hour at room temperature with the secondary antibody Alexa Fluor 594 donkey anti-mouse IgG (H + L) A21203 and Alexa Fluor 488 donkey anti-rabbit IgG (H + L) A21206 diluted in the same solution as the primary antibody. Nuclei were counterstained using 4′,6-diamino-2-phenyldole (DAPI) with Vectashield (Vector Laboratories).
Brain tissue immunohistochemistry. Immunohistochemistry was performed using a rabbit monoclonal anti-tyrosine hydroxylase Th antibody (1:400, Abcam ab112), a rabbit antibody against the glial fibrillary acidic protein (Dako Z0334 polyclonal antirabbit GFAP, 1:500) and a biotinylated anti-rabbit IgG (H + L) (1:100; Vector Laboratories, Burlingame, CA, USA). The immunohistochemical staining was developed using the avidin–biotin–peroxidase complex (1:10; ABC Kit; Vector Laboratories) and DAB (Sigma). Immunohistochemical labelling was observed with an Olympus BX53 microscope and images were digitized.
Confocal Microscopy. Triple-labeled images were obtained using a confocal laser-scanning microscope (Leica TCS-SP8) in the XYZ (Z-stacks) mode using a 63X (oil immersion) objective. The following excitation lasers/emission filters settings were used for the various chromophores: an argon laser was used for the Alexa Fluor 488, with a peak excitation at 490 nm and emission in the 505–530 nm range; a He-Ne laser was used for the Alexa Fluor 594 with a peak excitation at 543 nm and emission in the 568–615 nm range; and a UV laser was used to reveal DAPI with a peak excitation at 456 nm and emission in the 410–480 nm range, using the sequential acquisition of separate wavelength channels to reduce interference between channels. The Z-stacks (3–4 optical slices) were then converted into a three-dimensional projection image using the Leica LAS AF lite software.
High-performance liquid chromatography (HPLC). Briefly, dopamine levels were determined using an HPLC method with electrochemical detection as previously described (31, 32). The separation of Dopamine and DOPAC was performed using a dC-18 microbore column (Atlantis, 2.1 x 150 mm, Waters Co.). The mobile phase was: buffer 97%, NaCl 135 mg/l; citric acid 10.5 mg/l; EDTA 20 mg/l; OSA 20 mg/l; methanol 3%, pH 2.9 adjusted with NaOH. The flow rate was 0.3 ml/min at 30°C. The electrochemical detection system was an Intro; Waters Co. coupled to a glassy carbon electrode (VT-03, Antec Leyden). The oxidation potential was þ380 mV vs. silver/silver chloride reference electrode (ISSAC).
6-OHDA stereotaxic lesion surgery. Rats were anesthetized with Ketamine 75 mg/kg and Xylazine 5 mg/kg i.p; placed on a David Kopf stereotaxic frame and injected unilaterally with 6-hydroxydopamine (6-OHDA by Sigma, cat. no. H4381); 16 µg/ µl of saline containing 0.1% ascorbic acid) in the medial forebrain bundle at coordinates (AP − 1.8; ML 2.4; DV − 7 mm) relative to bregma according to the rat brain atlas of Paxinos and Watson(33), 5 µL were administered at a rate of 1µL per minute. To prevent noradrenergic neuron damage, rats were pre-treated with desipramine (10 mg/kg i.p.) 40 min before the surgery. Twelve days after the 6-OHDA lesion, only rats showing ten or more ipsilateral turns/min 30 min after amphetamine injection were included in the study (34). A group of sham-lesioned rats with the surgical procedure but no stereotaxic lesion and administration of 6-OHDA was used as a control. We call lesioned side the right side administrated with 6-OHDA and as the intact side the left side that did not receive stereotaxic lesion and 6-OHDA administration.
Implantation of astrocytes. Hemi-parkinsonian rats (~ 300 g) were anesthetized with Ketamine/Xylazine (75/5 mg/kg i.p.) and placed on a David Kopf stereotaxic frame and received 20,000 astrocytes in each of the two sites in the lesioned striatum: anterior (AP 1.9; ML 2.2; DV -5) and posterior (AP 0.9; ML 3.0; DV -4) relative to bregma according to the brain atlas of Paxinos and Watson (33). Astrocytes (AST) and astrocytes expressing Th (AST-TH) were trypsinized from 90% confluent 60 mm Petri dishes, counted, and 20,000 cells were immediately concentrated in 3–4 µl of culture medium without serum to be used for the implant procedure(35). Sham-lesioned rats did not receive implants.
Behavioral tests. Rats were trained for two weeks before the 6-OHDA lesion. Two weeks after the 6-OHDA lesion, astrocytes and AST-TH were implanted in the striata of experimental subjects. Implanted rats were evaluated for the following nine weeks. Experimental and control rats were sacrificed ten weeks after the lesion to obtain striatal tissue for HPLC, immunofluorescence, and western blot assays.
Amphetamine-induced rotations test. Rats were challenged with amphetamine (8 mg/kg i.p. Sigma, cat. no. NMID420D) and tested for ipsilateral circling behavior; the number of turns per minute was measured and recorded for 30 minutes, 15 minutes after the peritoneal administration of amphetamine(36).
Cylinder test. The test was performed as follows: Rats were placed individually inside an acrylic cylinder (diameter, 22 cm; height, 26 cm) with a mirror behind it at a 45˚ angle to allow 360˚ vision. Rats were video recorded for 5 min after they first touched the cylinder walls with the impaired or unimpaired forelimb or both simultaneously. Scores were calculated by the asymmetry ratio: right-left/ (right + left + both). Scores on the forelimb asymmetry ratio range from ‑1 to 1(37, 38).
Inclined beam balance test. Animals were trained for three days to walk along 2 m long beams from the starting platform to a cage on the upper part; animals were presented with a negative stimulus in the base of the beam as a yellow light lamp and a sugar cookie reward in the dark cage. The beams were inclined at 15°; two different beams with 24- and 18-mm widths were used. The animals were tested for the basal measure four days after the start of the training before the 6-OHDA lesion. The test recorded the time it took the animals to walk from the base of the beam to the cage at the end of the shaft. Only animals that completed the test in less than 120 s during the basal determination were included in the experiment (39).
Statistical analysis. Results are expressed as mean ± SD (n = 4). We used GraphPad Software version 8.0 to analyze the results. We evaluated data distribution with the Shapiro-Wilk test. Dopamine HPLC determination was analyzed with Brown-Forsythe ANOVA and Welch´s ANOVA test with a two-stage linear step-up procedure of Benjamini, Krieger, and Yekutieli test as post hoc. DOPAC/DA ratio and Th densitometry comparison were analyzed by One-Way ANOVA and Tukey´s multiple comparations test as post hoc. P < 0.05 was considered statistically significant.
Amphetamine-induced rotation test data were analyzed with a two-way ANOVA with Sidak´s multiple comparisons test post hoc. Forelimb placement asymmetry, Inclined beam motor balance test (24 mm), and Inclined beam motor balance test (18 mm) data were analyzed with Repeated Measures ANOVA and Tukey´s multiple comparison test as a post hoc test. P < 0.05 was considered statistically significant.