The aim, Research Design, and setting of the study
The study aimed at characterizing the variations in TRIM5α and CypA genes among Ugandan HIV-1 elite controllers and non-controllers.
A laboratory-based crossectional study was conducted utilizing PBMC samples from the Elite study cohort. The Elite study was conducted between 2016 and 2018 and its aim was to examine the role of host genes in T cell resistance to HIV among Elite and Viremic controllers in Uganda. The Elite study recruited participants from Makerere University Joint Aids Program (MJAP) ISS clinic.
The laboratory experiments were conducted at Makerere University College of Health Sciences, Molecular and Immunology Laboratories. Other assays were conducted at the Center For AIDS Research (CFAR) laboratory, Joint Clinical Research Center in Kampala, Uganda.
Participant characteristics
The study utilized PBMC samples from two (2) patient groups, namely; a) HIV-1 elite controllers (undetectable viral load with >5 years in care without ART) and b) non-controllers (HIV infected individuals well controlled on ART).
Elite controllers were selected basing on the following criteria; HIV infected individuals >18 years old, have been confirmed to be HIV infected by HIV RNA PCR using Abbort real-time HIV-1 Assay (Abbott Molecular, USA), ART naïve for ≥ 5 years with CD4+ T cell count of ≥500cells/ml, have a viral load of <50copies/ml, have a hemoglobin concentration >10g/dl and are able to give written informed consent. Non-controllers were defined as HIV-1 infected individuals who are well controlled on ART. Being well controlled on ART meant CD4+ T cell count of >500 cells/ml and no opportunistic infections. All those with active opportunistic infections e.g Pneumocystis jiroveci pneumonia (PJP), Tuberculosis(TB), platelets <50 and Bleeding disorders were excluded from the study.
Laboratory Methods
Sample Processing and Thawing
PBMCs were retrieved from liquid nitrogen and immediately thawed in a water bath set at 370C. Thereafter, they were transferred into 10ml of R-10 media and then centrifuged at 1500rpm for 10 minutes. The supernatant was decanted, and the pellet resuspended in 5ml R-10 media (10% FBS, 1%Pen-strep, 1% L-Glutamine, 1% Hepes Buffer, and RPMI) for counting. The cells were stained with trypan blue and counted using an automatic cell counter (Invitrogen, Carlsbad, CA, USA ). 1ml of the sample was removed for DNA extraction.
CD4+ T cell Isolation
The thawed PBMCS were subjected to CD4+ T cell isolation using human CD4+ T cell enrichment magnetic kit following the manufacturer's instructions (StemCell Technologies, Vancouver, Canada). The isolated CD4+ T cells were washed in 1ml PBS, centrifuged at 1500rpm for 10 minutes. These were resuspended in 2ml R-10 media, stained for counting with trypan blue and then incubated at 370C on a 24 well plate for 2 hours in a CO2 incubator. The cells were also stained for purity using anti-CD3, and anti-CD4 and ran on a BD FACS Canto II (BD Biosciences, Franklin Lakes, New Jersey, USA)
CD4+ T cell Stimulation
A 96-well plate coated with 100μl of 5μg/ml of Anti-CD3 (eBioscience Clone CD28.2) was incubated at 370C for 2 hours in a CO2 incubator. For negative control wells, 100μl of PBS was added. After the 2 hour incubation, the plate was bloated. In each well, 100,000 cells from the sample were added and topped up with R-10 media containing 5 μg/ml of anti-CD28 (eBioscience clone OKT3) to make 200 μl per well. For negative control wells, 110μl of PBS was added. The plate was incubated at 370C for 48 hours in a CO2 incubator
RNA extraction
RNA was extracted using Quick-RNA™ Whole Blood kit (Zymo Research, CA, U.S.A) following the manufacturer’s instructions. The CD4+ T cell samples previously suspended in RNAlater (Sigma-Aldrich, St. Louis, Missouri, US) were centrifuged at 10.000g for 1 minute and then decanted. The pellet was re-suspended in 300μl of DNA/RNA Shield™ then 30μl PK digestion buffer and 15μl Proteinase K added to the sample and mixed well. The mixture was incubated at 55°C for 30 minutes. After incubation, the sample was vortexed and then centrifuged at 16,000g for 2 minutes. The supernatant was transferred into RNase-free eppendoff tubes. To the supernatant, 350μl of RNA recovery buffer was added and mixed well, transferred into a Zymo-Spin™ IIICG Column in a Collection Tube and centrifuged at 16,000g for 30 seconds. To the filtrate, 700μl of 100% ethanol was added and mixed well. The mixture was transferred into a Zymo-Spin™ IC Column in a Collection Tube, centrifuged at 16,000g for 30 seconds and then the filtrate discarded. This was followed by DNase treatment to remove extra traces of DNA in the column. To achieve this, the column was washed with 400 μl RNA wash buffer and centrifuged at 16,000g for 30 seconds and thereafter the filtrate discarded. A Mixture of 5μl DNase and 35μl DNA digestion buffer was made and added directly to the column matrix. The column was incubated at room temperature for 15 minutes. After DNase treatment, 400 μl RNA prep buffer was added to the column and centrifuged at 16,000g for 30 seconds. The filtrate was discarded, and 700 μl RNA wash buffer added to the column and centrifuge at 16,000g for 30 seconds. The filtrate was discarded, 400 μl RNA wash buffer added and then centrifuged for 2 minutes at 16,000g. The column was then transferred into an RNase free eppendoff tube, thereafter, 15μl DNase/RNase-free water added directly onto the column matrix to elute RNA. The eluted RNA was quantified by Qubit 4 Fluorometer (Invitrogen, Carlsbad, CA, USA). The RNA was then immediately stored at -800C prior to downstream processes.
3.8.2 cDNA synthesis and Reverse transcription PCR
Extracted RNA was subjected to cDNA synthesis and real-time PCR using QuantiTect Probe RT-PCR Kit (Qiagen Inc., Valencia, CA, USA) as described in the manufacturer's instructions. A 50μL reaction volume was used for the PCR. Primers and probes used were obtained from a previous study (23) and are summarized in table 1. For each gene to be measured, separate master mix containing; a) 25μL 2x QuantiTect Probe RT-PCR Master Mix(HotStarTaq® DNA Polymerase, QuantiTect Probe RT-PCR Buffer, dNTP mix, including dUTP, ROX™ passive reference dye, and MgCl2), b) 2μL of each of the forward and reverse primers, c)1μL of the probe, d) 0.5μL of the QuantiTect RT Mix, and e) 12 μL of the RNase free water. In every PCR tube, 42μL of the master mix was added, and then 4μL of RNA template added in 3 tubes containing master mix of the 3 respective genes namely; GAPDH (reference gene), Cyclophilin A (target gene), and TRIM5α (target gene). For each of the genes, a negative control was added in each of the experiments containing mastermix and PCR water but no RNA template added. The PCR tubes were loaded into the Rotor gene Q real-time PCR machine (Quiagen Inc, Valencia, CA, USA) and PCR set using the following conditions; reverse transcription (cDNA synthesis) at 550C for 30 minutes, PCR initial activation at 950C for 15 minutes, followed by 45 cycles of denaturation at 940C for 15 seconds, and combined annealing and extension 600C for 60 seconds. Ct values for each gene were obtained and analyzed using the delta CT relative quantification method to determine the fold change in gene expression.
Table 1: Primers and probes used in reverse transcriptase PCR to quantify expression of TRIM5α, CypA and GAPDH
Protein
|
Primers and probes(Tamra)
|
TRIM5α F
|
5'- TGCCTCTGACACTGACTAAGAAGATG
|
TRIM5α R
|
5'- GGGCTAAGGACTCATTCATTGG
|
TRIM5α Probe
|
5'- (6-Fam)AAGCTTTTCAACAGCCTTTCTATATCATCGTGTGATA
|
CypA F
|
5'- GGCCGCGTCTCCTTTGA
|
CypA R
|
5'- AATCCTTTCTCTCCAGTGCTCAGA
|
Probe
|
(6-Fam)TGCAGACAAGGTCCCAAAGACAGCAG
|
GAPDH F
|
5'- ACCCCTGGCCAAGGTCATC
|
GAPDH R
|
5'- AGGGGCCATCCACAGTCTTC
|
Probe
|
5'- (6-Fam)AGGACTCATGACCACAGTCCATGCCA
|
DNA extraction
DNA was extracted using the Qiagen Blood Genomic DNA Kit (QIAamp DNA kit; Qiagen, Inc., Valencia, CA, USA) in accordance with the manufacturer's instructions as used in the previous studies (24). 20 μl of Qiagen Protease was pipetted into the bottom of a 1.5 ml microcentrifuge tube, then 200 μl sample added. 200 μl Buffer AL was then added to the sample and mixed by pulse-vortexing for 15seconds. The mixture was incubated at 56°C for 10 min and centrifuged to remove drops from the inside of the lid. 200 μl ethanol (96–100%) were added to the PBMCs and mixed again by pulse-vortexing for 15 seconds. After mixing, the tube was again centrifuged to remove drops from the inside of the lid. The reaction mixture was applied to the QIAamp Mini column, centrifuged for 6000g for 1 minute and the filtrate discarded. The column was placed in a clean 2ml collection tube. 500 μl of Buffer AW1 was then added to the QIAamp Mini column and centrifuged at 6000g for 1 minute. The tube containing the filtrate was discarded and the column placed in a new clean collection tube. 500μl Buffer AW2 was also added, centrifuged at 20,000g for 3 minutes and the tube containing filtrate discarded. The column was placed in a new collection tube, centrifuged at 20,000g for 1 minute and the tube containing filtrate discarded. The QIAamp Mini column was then placed in a clean 1.5 ml microcentrifuge tube and 200 μl Buffer AE added. The mixture was incubated at room temperature for 1 minute and then centrifuged at 6000xg for 1 min to elute DNA. The extracted DNA was stored at -80°C prior to PCR amplification.
PCR Amplification
Exon 2 of TRIM5α gene
PCR amplification of TRIM5α gene (5’UTR, exon 2 & intron 2) was carried out with 35 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 68°C for 45 s using SuperScript III platinum Taq polymerase (Invitrogen, Carlsbad, CA, USA) in the presence of 2X reaction buffer, 5mM MgCl with primers summarized in Table 2 as described in a similar study (12).
Table 2: Table 2: Primers for amplification of of TRIM5α gene
Location
|
Primer
|
F
|
TGCAGGGATCTGTGAACAAG
|
R
|
CCATCTGGTCCCATTTTCTG
|
Cyclophillin A gene promoter
PCR amplification of the Cyclophilin A gene was carried out with 40 cycles of denaturing at 95 °C for 30 s, annealing at 65°C for 45 s, and extension at 68 °C for 45 s using SuperScript III platinum Taq polymerase (Invitrogen, Carlsbad, CA, USA) in the presence of 2X reaction buffer, 5mM MgCl with primers summarized in Table 3 as described in a similar study (20).
Table 3: Primers used for amplification of Cyclophillin A promoter
Location
|
Primer
|
C1604G-F
|
GCACTGTCACTCTGGCGAAGTCGCAGAC
|
P4H-R
|
GCCGAGCACGTGCGTCGGACAGGAC
|
PCR Clean up
From all samples positive on gel electrophoresis that have a single band, 10ul was aliquoted into a new PCR tube and 2ul of ExosapIT reagent added. The tubes were then transferred into a thermocycler (Applied Biosystems, California, United States) and ran under the following conditions: 37oC for 45 minutes, 80oC for 45 minutes and held at 4 oC. Thereafter, PCR products were stored at -200C prior to Sanger sequencing.
Sanger sequencing
Cycle sequencing
Sequencing mastermix was prepared including 0.5μl of big dye terminator, 1.75μl of 5X sequencing buffer, 2.5μl of primer, and 4.25μl of water for the 10μl reaction. 9μl of the master mix was added into each plate well and 1μl of the sample was then added. The plate was loaded in a SimpliAmp thermocycler (Applied Biosystems, California, United States), and run under the following conditions; 960C for 1 minute, then 30 cycles of 960C for 20 seconds, 500C for 20 seconds, and 600C for 4 minutes. Thereafter, the plate was held at 40C awaiting cleaning.
Clean up
Ethanol precipitation was done as follows. The 96-well sequencing reaction plate was removed from the SimpliAmp thermocycler and the plate centrifuged at 1000rpm for one minute without cooling. To each well, 2.5μl of 125mM EDTA was added, followed by 1.0μl 3M Sodium Acetate pH 5.2 and then 30μl of Absolute Ethanol to each well. The plate was sealed and vortexed briefly for 5s., then incubated at room temperature for 30 minutes to precipitate the extension products. The plate was centrifuged at 3000rpm for 60 minutes, at 4ºC. The plate cover is then removed, and the plate inverted on a paper towel placed in the microplate carrier assembly in the plate centrifuge. Centrifuge at 500rpm for one minute. 100μl of 70% Absolute Ethanol were added to each plate well and the plate heated at 90oC for 1 min in a SimpliAmp thermocycler (Applied Biosystems, California, United States).
Electrophoresis
10µl of 0.1mM EDTA was added to each sample well and the plate sealed. The plate was vortexed for 5s and then centrifuged at 1000rpm for one minute without cooling to bring down the contents of the wells. The samples were then ready to run in the 3730xl DNA analyzer (Applied Biosystems, California, United States).
Data analysis
Data was entered in excel and exported to GraphPad prism v8 for analysis. CD4+ T cells were analyzed on an 8-laser FACS Canto II (BD Bioscience). Approximately 50,000 events were recorded per sample. In addition, antibody capture beads (BD Bioscience) were used for compensation and prepared individually by separate staining of all the antibodies used in the experiment. FlowJo X 10.6 (Treestar) was used for gating analysis, and statistical analysis was performed with GraphPad Prism 6.0. For mRNA quantification, relative quantification using the obtained CT value was done using the delta CT method. Statistical differences between the different groups were determined using the unpaired t-test in Graph pad prism v8. Sequence analysis was done using Mutation Surveyor software to identify SNPs in the respective genes. Frequencies and percentages of the SNPs were determined. SNPs in the coding region were analysed using the gnomAD to determine the amino-acid change.