Cell lines and transfection
In our previous studies, we had established radiation-tolerant CNE-2R cells. Cells were maintained in RPMI-1640 (Gibco, Grand Island, NY, USA) medium containing 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA) at 37℃ in 5% CO2 incubator. The GV248-Puromycin-EGFP-shRNA-VEGF lentiviral vectors and GV358-3FLAG- Puromycin-EGFP-VEGF lentiviral vectors (Genechem, Shanghai, China) were transfected into CNE-2R cells. The transfection effect was verified by qPCR and western blotting. The molecular sequence of VEGF was obtained in GenBank (No.NM_001171626).
RT-qPCR analysis
Total RNA was isolated from cells with TRIzol reagent (Takara, Dalian, Japan), and then reverse-transcribed into cDNA. The SYBR® Premix Ex TaqTM II (Takara, Dalian, Japan), dH2O, cDNA, and primers were mixed to prepare a qPCR reaction system, and a RT-qPCR reaction was performed. The relative quantitative analysis of mRNA was conducted by the 2-ΔΔct method. The primers were as follows: (5′→3′): VEGF-F: TCACAGGTACAGGGATGAGGACAC, VEGF-R: CAAAGCACAGCAATGTCCTGAAG; GAPDH-F:CAGGAGGCATTGCTGATGAT, GAPDH-R: GAAGGCTGGGGCTCATTT.
Western blot analysis
Total protein was isolated from cells by RIPA (Beyotime, Shanghai, China) protein lysate. Quantitative detection of protein was conducted by the BCA (Beyotime, Shanghai, China) method. Thereafter, 20 μg of protein sample was added to appropriate amount of 4× loading buffer and denatured by heating. After electrophoresis by SDS-PAGE (6%-12%), the proteins were then transferred to PVDF membranes and blocked with 5% skimmed milk. The corresponding primary and secondary antibodies were incubated with the membranes. The bands were exposed with ECL chemiluminescence and analyzed with gel imaging system.
Clonogenic Assay
Cells at densities of 200, 200, 400, 600, 1000 cells/well were added to a six-well plate according to the 0, 2, 4, 6 and 8 Gy irradiation doses. After 24 hours of culture, cells were subjected to different irradiation with 6 MV X-rays, and then cultured for 2 weeks. The medium was discarded, and the cells were fixed with 4% paraformaldehyde (Solarbio, Beijing, China) and stained with Giemsa stain (Solarbioo, Beijing, China). More than 50 cells were considered to be an effective colony, and the relevant parameters were calculated, clonal formation rate (PE) = number of effective colonies / number of cells inoculated, survival fraction (SF) = PE of irradiated cells / PE of non-irradiated cells. Based on the multi-target model, we fitted the cell survival curve by using the GraphPad Prism 5.0 software, and D0 (=1/k), Dq (= lnN * D0) and SF2 were calculated.
Cell Counting Kit 8
Cell suspensions at 4×103 cells/well were added to 96-well plates. After incubating for 24 hours, the cells were subjected to different irradiation with 6 MV X-rays and then cultured for another 48 hours. After that, adding 10 μL of CCK-8 (Dojindo, Shanghai, China) for every 100 μL medium and incubating for 1 h. The microplate reader (Thermo Fisher, USA) was used to measure the absorbance value of each group at 450 nm and the SF of cell was calculated.
Cell Cycle Analysis
After all groups of cells were irradiated with 0 Gy or 8 Gy with 6 MV X-rays for 48 hours, 5×105 cells were collected from each group and washed with PBS. Each group was fixed with 1mL of 75% pre-cooled ethanol at -20℃ overnight, and washed with PBS. Then, 0.5 mL PI/RNA staining buffer (BD, New Jersey, USA) was added for 20 min . All cells were filtered with a nylon filter and detected by flow cytometer .
Apoptosis Analysis
After all groups of cells were were rradiated with 0 Gy or 8 Gy with 6 MV X-rays for 48 hours, 5×105 cells were collected from each group and washed with PBS. After that, cell suspension were added 7 μL Annexin V-APC /7-AAD (BD, New Jersey, USA) for 20 min. Thereafter, the cells were filtered with a nylon filter and detected by flow cytometer (BD, New Jersey, USA).
Immunofluorescence
The two groups of cell suspensions were inoculated on coverslips, and they were irradiated with 8 Gy irradiation after 24 hours of culture. At indicated time points(1, 3, 6, 12 and 24 h), 4% paraformaldehyde was used to fix the cells, which then treated with Immunol staining blocking buffer for blocking. Briefly, the NPC cells were incubated with primary and secondary antibodies. Finally, nuclei were counter-staining with DAPI solution, and coverslips were mounted with Antifade polyvinylpyrrolidone mounting medium. The EVOS FL Auto microscope (Life technologies, USA) was used to take images, and the number of cells which expressed the target proteins in the cytoplasm and nucleus were counted.
Co-immunoprecipitation(Co-IP)
The proteins of the vector group and the VEGF group were extracted separately, and the specific steps are as described above. 40 μL of Anti-Flag® M2 Affinity Gel was thoroughly mixed with 1 mL PBS, centrifuged and discarded the supernatant. 500 μL of total proteins were mixed with the above precipitate, and then incubated them overnight at 4℃. Subsequently, the mixture was centrifuged again and discarded the supernatant. 4×SDS-PAGE binding buffer were put into the precipitate and denatured by heating at 100℃. Then, the next steps of gel electrophoresis were the same as that of western blot analysis.
In vivo nude mouse models
Male athymic 4-week-old BALB/C nude mice were housed under specific pathogen free (SPF) conditions in Experimental Animal Center of Guangxi Medical University. Two group cells (4×106) were implanted into the right groin of nude mice. There are 6 mice in each group, and each mouse is marked with an ear tag. When the tumor diameter was about 1 cm, 3 mice from each group were randomly selected for 8 Gy irradiation. All mice were sacrificed after observation for about 12 days after irradiation. During the periodical measurement of tumor size, calculate tumor volume according to the following formula: V = width2×length ×0.5. Tumor tissues were submerged in formalin for hematoxylin and eosin (H&E) staining.
Immunohistochemistry (IHC)
The paraffin-embedded tissue slides were baked in 60℃ incubator for 2 h, and then dewaxed, hydrated, antigen recovered and the endogenous peroxidase was eliminated. Subsequently, the primary and secondary antibodies were droped on the slides and incubated. The staining intensity was recorded: 0 (no staining), 1 (light yellow), 2 (yellow), 3 (brownish yellow). The percentage of stained cells was recorded: 1 (0-25%), 2 (26%-50%), 3 (51%-75%) and 4 (76%-100%). Then multiply the score of staining intensity and percentage stained cells to get the immunoreactivity score of each tissue, and it was classified into two grades: low (0-3) or high (4-7).
TUNEL
TUNEL assay was detected with the commercial Tunel kit (Roche, Basel, Switzerland) according to the instruction of manufacture. The tunel-positive cells were regarded as apoptotic cells by observing the sections on the fluorescence microscope (EVOS FL Auto) and analyzing five randomly selected regions of each slide. The apoptotic index was calculated as a percentage of apoptotic nuclei to total nuclei.
Statistical Analysis
All statistical results were analyzed using SPSS 17.0 and GraphPad Prism 5.0 softwares. All data are expressed as means±standard deviation. Statistical p values were analyzed by Students’ t tests or one-way ANOVAs. P<0.05 was supposed to indicate statistical significance. Each experiment was repeated three times.