Cells and cell cultures
This study received the approved of the Ethics Board of Kunming General Hospital and was also conducted in accordance with the Helsinki Declaration institute of 1975. The MDA-MB-435 human breast cancer cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA), and were grown in RPMI-1640 Medium supplemented with 10% heat-inactivated fetal bovine serum (FBS, Biological Industries, Inc., Israel, USA), 100 units/mL penicillin and 100 µg/mL streptomycin in humidified conditions with a 5% CO2 at 37 °C.
RNA preparation and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis
Total RNA of cells was extracted using the TRIzol reagent (mrcgene, OH, USA) and reverse transcribed to cDNA using the RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, Waltham, USA). The iTaq™ Universal SYBR Green Supermix kit (Bio-Rad, Hercules, USA) was used to perform PCR amplification on the CFX96™ Real-Time PCR Detection System. The expression of RNA was normalized to the level of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Data were analyzed using the Bio-Rad CFX96 Manager software. The sequences for qRT-PCR are listed in Table 1.
Table 1
Primer NO. | Primer sequence | Tm(℃) | Product |
CD44 transcript variants1 F | GAGCAGCACTTCAGGAGGTTA | 60 | 119 bp |
CD44 transcript variants1 R | TCATCAAAGTGGTAGCAGGGA |
CD44 transcript variants2 F | CAGGAGGTTACATCTTTTACACC | 60 | 112 bp |
CD44 transcript variants2 R | TTTGAAGACGTACTGGTAGCAG |
CD44 transcript variants3 F | TTCAGGAGGTTACATCTT | 60 | 78 bp |
CD44 transcript variants3 R | ATATTGGTAGCAGGGATT |
CD44 transcript variants4 F | CAGCACTTCAGGAGGTTACATC | 60 | 120 bp |
CD44 transcript variants4 R | GTGTCTTGGTCTCTGGTAGCA |
CD44 transcript variants5 F | GCTGACCTCTGCAAGGCTTTC | 60 | 99 bp |
CD44 transcript variants5 R | ACTGCA ATGCAA ACTGCAGGT |
CD44 transcript variants6 F | TTCAGGAGGTTACATCTT | 60 | 111 bp |
CD44 transcript variants6 R | TCATTCCTATTGGTAGCA |
CD44 transcript variants7 F | GCAGCACTTCAGGAGGTTAC | 60 | 119 bp |
CD44 transcript variants7 R | ATGTGAGTGTCTGGTAGCAGG |
CD44 transcript variants8 F | AGAATTATGGACTCCTTAC | 60 | 187 bp |
CD44 transcript variants8 R | CTCAATGGTATAGATAGCA |
GAPDHF | TGACAACAGCCTCAAGAT | 58 | 103 bp |
GAPDHR | GAGTCCTTCCACGATACC |
CD44F | CAGCACTTCAGGAGGTTACATC | 58 | 120 bp |
CD44R | GTGTCTTGGTCTCTGGTAGCA |
Bcl-2F | GAGTGCTGAAGATTGATG | 58 | 110 bp |
Bcl-2R | TCCTCTGTGATGTTGTATT |
Cyclin E2F | GTTCTTCTACCTCAGTATTCTC | 58 | 114 bp |
Cyclin E2R | AGCAGCAGTCAGTATTCT |
EGFRF | CTGGTTATGTCCTCATTG | 58 | 120 bp |
EGFRR | CATAGTTAGATAAGACTGCTA |
MMP7F | CAGTGATGTATCCAACCTAT | 58 | 157 bp |
MMP7R | CAATCCAATGAATGAATGAATG |
Muc1F | ACTTCTGCCAACTTGTAG | 58 | 79 bp |
Muc1R | AAGAACCTGAGTGGAGTG |
MycF | CTCAAGTCATAACAATGCTAA | 58 | 100 bp |
MycR | AATCAACAGTATCTCCTTCA |
Flow Cytometric Analysis
To isolate the CD44+/CD24− cells from MDA-MB-435 cells, flow cytometric analysis was performed as previously described [18]. Briefly, 2 × 106 cells were harvested and washed with 1X PBS. PE-conjugated mouse anti-human CD44 monoclonal antibody and fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD24 monoclonal antibody (all from BD Biosciences, Franklin Lakes, USA) were added to the cells, respectively. After 20 min incubation on ice and in the dark, cells were washed twice with chilled 1X PBS containing 2% FBS followed by cell sorting using the flow cytometer (BD FACSVantage SE) [19].
For cell cycle assessment, cells were harvested and washed twice by 1X PBS, and fixed in 80% ethanol for 30 min at 4 °C. After washing the cells twice with 1X PBS, they were suspended in 200 µL propidium iodide (PI, 0.1 mg/mL, BD Biosciences) and 200 µL RNase A (1 mg/mL). After 30 min incubation on ice and in dark [20], cells were scanned by flow cytometer and data were analyzed using the FlowJo software V7.6.
To detect apoptosis, cells were washed gently with PBS to make a cell suspension followed by centrifugation at 500 g for 5 min. Using 200 µL Binding Buffer, the cells were resuspended at a cell density of 2–5 × 105 cells/mL. Then, 5 µL Annexin V- FITC (BD Biosciences) was added to the 195 µL cell suspension followed by incubation at room temperature in dark for 10 min. A total of 190 µL binding buffer and 10 µL of PI was added to the cells, and incubated in dark at 4 °C for 30 min. The cell suspension was filtered with 300 mesh nylon mesh. Apoptosis was measured using flow cytometry.
Plasmids And Transduction
The CD44s-shRNA (Target to CD44 standard isoform transcript variant 4, CD44s, target sequence was GGAAGAAGATAAAGACCATCCTTCAAGAGAGGA
TGGTCTTTATCTTCTTCCTT) and NC-shRNA (Negative Control) were generated by Shanghai GenePharma Co. (GenePharma Co,Ltd, Shanghai, China). The sequences were inserted into the Bbs I and BamH I positions of plasmid pGPU6/GFP/Neo with GFP reporter gene. With this approach, the target sequences were placed between the hU6 promoter and the SV40 polyA signal (Fig. 3).
Plasmids, pGPU6-CD44s and pGPU6-NC, were transfected into the BCSCs by mixing with Lipofectamine™ 2000 reagent (Invitrogen, Beijing, China) according to the instructions of the manufacturer. Subsequently, 24 h after transfection, cells were passaged and were cultured in RPMI-1640 medium containing 10% FBS and 400 µg/mL G418. After 10 days, 200 µg/mL G418 was added to the culture in order to maintain the screening pressure. G418-resistant clones were visible approximately 14 days after the selection pressure was applied. After subsequent culture of these clones, we obtained two cell lines with stable expression of CD44s-shRNA (CD44s-shRNA group) and NC-shRNA (NC-shRNA group) [21]. CD44s knockdown was confirmed using qRT-PCR.
Cell Proliferation And Colony Formation Assay
The CD44s-shRNA, NC-shRNA, and untransfected BCSCs were plated in 24-well plates with 1 × 104 cells per well and incubated at 37 °C. Cell proliferation was assessed on day 1, 2, 3, 4, 5, 6, and 7 after transfection by counting the average of three random wells. After observing for seven days, the proliferation curves were drawn. For the colony formation assay, 1000 cells from each group were plated in 6-well plates. After about 4 days, when the cell number of one clone was about 50, the cells were fixed with formaldehyde and stained using Giemsa staining. The number of clones was determined using images.
Tumor Sphere Formation Assay
The CD44s-shRNA, NC-shRNA, and untransfected BCSCs were seeded in ultralow attachment plates (Corning, USA) at a density of 3 × 104 viable cells/mL in primary culture, respectively. They were then cultured in a sphere culture medium containing serum-free DMEM-F12 (HyClone, Utah, USA), B27 (1:50, Gibco, USA), 10 ng/mL EGF (Peprotech, Rocky Hill, USA), 20 ng/mL bFGF (Peprotech, Rocky Hill, USA), and 5 µg/mL insulin (Sigma, USA). After 5 days, the primary sphere was collected and blown mechanically to a single cell by enzyme digestion (10 min in 0.05% trypsin, 0.53 mM EDTA-4Na; Invitrogen, USA). The single-cell were cultured to the next generation. The size and percentage of microspheres were calculated after two weeks[22].
The Matrigel Invasion Assay
The invasion assay was cultured in a transwell chamber (24-well, 8 mM pore size, Corning). The three groups of cells were plated in the upper chamber with 100 µL serum-free RPMI containing 0.2% BSA (1 × 105 cells), respectively. A total of 400 µL RPMI containing 20% FBS was placed in the lower chamber as chemoattractant. After 48 h, the cells at the lower surface of the chamber membranes (migrated) were fixed with 90% ethanol and stained with hematoxylin. The number of migrated cells was counted under the microscope in ten random high power fields (400) per membrane [23].
Tumor Growth And Morphologic Analysis In Vivo
All animals were handled in strict accordance with good animal practices as deemed by the relevant national and local animal welfare bodies, and in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. A total of 12 six-week old female NOD/SCID specific pathogen-free (SPF) mice (Vital River Laboratories, Beijing, China) were fed under SPF conditions, and randomly divided into four groups. A total of 106, 105, 104, and 103 BCSCs were subcutaneously injected into the left back of the four groups of mice, respectively, while each group of mice was subcutaneously injected with BCSCs stably expressing CD44s shRNA into the right back. The subcutaneous tumor formation as well as tumor size and weight of nude mice were observed every two days about 60days.When the tumor diameters reached 2000 mm, the mice were anaesthetized by intraperitoneal administration of 2% pentobarbital sodium (45 mg/kg), and then euthanized by rapid cervical dislocation. The dynamic observation of tumor growth was monitored with calipers using the following formula: Volume = 1/2 (width2 × length) [24].
Histopathology, Immunohistochemistry, And Immunofluorescence
The cells growing on glass slips and tissue sections of the paraffin-embedded tumor blocks were subjected to hematoxylin and eosin (H&E) staining [25]. Immunohistochemistry staining was carried out as follows: peroxide was used to block the activity of endogenous peroxidase after PBS flushing followed by addition of CD44 antibody (clone 156-3C11, Newmarkers; 1:200) and CD24 antibody (clone SN3b, Newmarkers; 1:50) at room temperature, and overnight incubation at 4 °C. Next, biotin-labeled secondary antibody was added followed by DAB staining and hematoxylin restaining. The sections were photographed with microscope scan and analyzed by two pathologists. The Allred immunostaining scoring system was used for semiquantitative evaluation in the three groups of cells [26].A total score was calculated by the sum of the proportion and intensity score,and the staining intensity was scored as 0 (none), 1 (mild), 2 (moderate), or 3 (strong); the proportion of stained cells was scored as 0 (none), 1 (> 0–1%), 2 (≥ 1–10%), 3 (> 10–33%), 4 (> 33–66%), and 5 (> 66–100%).
For immunofluorescence, the cells growing on glass slips and the frozen sections of tissues [27] were fixed with acetone for 15 min, followed by three washes with 1X PBS. Then, the tissue sections were incubated with PE-conjugated anti-human CD44 antibody and FITC-conjugated anti-human CD24 antibody (BD Biosciences) [28]. After washing twice with 1X PBS, a drop of glycerol was added on a glass slide, and the slide was analyzed under a fluorescence microscope (Nikon, Tokyo, Japan). The images were acquired using the accompanying software package.
Statistical Analysis
Each result is expressed as the mean ± standard deviation. All experiments were performed in triplicates. All statistical analyses were performed using the SPSS software version 11.0. Comparisons among all groups were performed using one-way analysis of variance (ANOVA) and the Student–Newman–Keuls method. Statistical significance is indicated by a P value less than 0.05.