5.1 Study design
This was a comparative cross-sectional study leveraging peripheral blood mononuclear cells (PBMC) samples collected by the Elite study that focused on the role of host genes in T cell resistance among elite and viremic controllers in Uganda. Cryopreserved PBMC samples collected from ART naïve HIV infected individuals followed for a duration greater than 5 years were used in this study.
5.2 Study Site Setting and Participants
Study participants were enrolled from Makerere University Joint AIDS Program (MJAP), Mulago ISS clinic. Patients who were ART naïve, maintained their CD4 count ≥ 500 cells/µl and their viral load of ≤ 2000 copies/ml for a period greater than 5 years were enrolled into this study. At enrollment, patients provided a peripheral blood sample, and HIV Viral Load was determined by qRT-PCR using Abbott Real Time HIV-1 assay (Abbott Molecular, USA). The time interval between initial viral load and enrollment viral load was determined and recorded in days. To confirm EC/VC status, a follow-up VL was performed and the time interval between baseline and follow-up VL was also calculated. Any individuals with a hemoglobin of < 10mg/Dl and active opportunistic infection were excluded.
5.3 PBMC Thawing: Cryopreserved PBMC samples were retrieved from liquid nitrogen at -1960C and immediately transferred to a preset 370C water bath. Upon thawing, cells were washed with R10 media composed of RPMI 1640 medium (ThermoFisher Scientific, South America, catalogue no. 11875093), 1% Pen-Strep, 1% L-Glutamine, 1% Hepes buffer and 10% Fetal Bovine Serum (ThermoFisher Scientific, South America, catalogue no. 10270106) in a 15ml centrifuge tube. We then determined cell yield where viability testing was done using Trypan blue solution. Cells were stained using 0.4% trypan blue solution at 1:1 dilution ratio. Samples with at least 80% viability were considered for CD4+ T cell isolation. A portion of cells harvested off in R10 media were used for DNA extraction and the rest for CD4+ T cell isolation.
5.4 CD4+ T cells Isolation and Stimulation
Following thawing, CD4+ T cell were isolated using the EasySepTM Human Isolation Kit (Stem Cell Technologies, Catalogue no. 19052). The stem cell Isolation protocol was followed. But briefly, cells were centrifuged at 1500rpm for 10 minutes, decanted and the pellet re-suspended in 1ml of 2% FBS containing 0.5% EDTA. The samples were transferred into FACs tubes from where 50μl of the enrichment cocktail were added and then incubated at room temperature for 10 minutes. Thereafter, 100 μl of the magnetic beads were added and the sample incubated at room temperature for 5 minutes. The sample tube (lid removed) was then placed in the EasySep magnet and incubated at room temperature for 5 minutes. In one continuous motion, the sample (isolated CD4+ T cells) was poured into a second tube after the 5 minutes’ incubation. The isolated CD4+ T cells were washed in 1ml PBS, centrifuged at 1500rpm for 10 minutes. These were re-suspended in 2ml R-10 media, stained for counting with trypan blue and then incubated at 370C on a 24 well plate for 2 hours in a CO2 incubator. The cells were also stained for purity using anti-CD3, and anti-CD4 and ran on a BD FACS Canto II (BD Biosciences, Franklin lakes, New Jersey, USA). Samples with an average purity of 98% and above determined after staining for flow cytometry were considered for stimulation. Prior to stimulation, the cells were rested in a 24-well-plate at 370C in a C02 incubator.
5.5. CD4+ T cell Stimulation
We prepared stimulatory antibodies; Anti-CD3 (eBioscience Clone CD28.2) and anti-CD28 (eBioscience clone OKT3) at a concentration of 5µg/ml each. A clearly mapped out 96-well plate was used. The plate was coated by adding 100 µl of anti-CD3 at a concentration of 5ug/ml and incubated for 2 hours. After incubation, the plate was blotted and 100,000 cells in 90µl per sample were added. Using a pipette, 110 µl anti-CD28 was added to each well to make a total final volume of 200µl at a concentration of 5ug/ml. For the negative control wells, 110µl of PBS was added to make volume of 200µl per well. The plate was incubated for a total of 48 hours at 370C in a CO2 incubator. After incubation, cells were washed with 200 µL staining buffer per well and then transferred to the 5 mm round bottomed polystyrene FACS tubes.
5.6 Cell Surface Staining
Subsequently, cells were surface stained and incubated for 30 minutes with the following monoclonal antibodies; CD3 Percyp cy5.5, CD4 APC, CCR5 PE, HLA-DR FITC, CD38 PE Cy7and Zombie Aqua (BD bioscience, San Jose, CA, USA). The cells were acquired on an eight-color FACS CANTO II (BD Biosciences, San Jose, CA, USA). At least 50,000 events were recorded for analysis. Gating was standardized and set using fluorescence minus one controls (FMOS). Data obtained were analyzed using FlowJo version 10.1 (San Carlos, CA, USA) and GraphPad Prism 7.0 (GraphPad Software Inc., La Jolla, CA, USA).
Table 3. Cell surface markers used as parameters to define CCR5 expressing T cell phenotypes
Cell Marker
|
Phenotype Function
|
CD3
|
T cell lineage marker
|
CD4
|
CD4+ T lineage
|
CD38
|
Immune activation
|
HLA-DR
|
Immune activation
|
CCR5
|
Chemokine receptor
|
5.7 DNA Extraction
DNA was extracted using the QIAamp DNA mini Kit (Qiagen, Inc., Valencia, CA, USA) in accordance with the manufacturer's instructions as used in the previous studies (39). 200μl of sample containing 2x106 cells was added to micro-centrifuge tube together with 20μl of Qiagen protease. 200μl of buffer AL was added to the sample which was then mixed thoroughly to ensure efficient lysis and then incubated at 560c for 10 minutes. 200μl of ethanol was added to the sample and then mixed by pulse vortexing. After vortexing, the mixture was added to span column (in a 2ml collection tube) and centrifuged at 8000rpm for 1 minute. The mini spin column was later placed into a clean 2 ml collection tube. The extracted DNA was washed using AW1 and AW2 and spun at 8000 rpm for 1 minute and 14000 for 3 minutes respectively. The empty column was span to prevent possible buffer AW2 carry over and later DNA was eluted using AE buffer into a new 1.5ml micro-centrifuge tube.
5.8 PCR and Sequencing
PCR amplification of CCR5 promoter region was carried out using the following cycling conditions; Initial denaturation at 95°C for 3 minutes; 31 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 2.40 minutes; followed by 68°C for 7 min. The PCR master mix contained High fidelity Super script III platinum Taq polymerase (Invitrogen, Carlsbad, CA, USA) in the presence of 2X reaction buffer, 5Mm MgCL2 with primers shown in table 2 developed using GenBank sequence with accession number U95626. as described in a similar study (40). The promote amplicon size was 2189 base pairs (40).
Table 4. Primers used in the amplification of Promoter 1 region of the CCR5 gene
Primer
|
Binding position
|
Amplicon size
|
Annealing temperature
|
Forward
5′CCAAGCACCAGCAATTAGC3′
|
58105 – 58122
|
2189
|
600C
|
Reverse
5′TGCCACCACAGATGAATGTC3′
|
60293 – 60274
|
600C
|
5.9 PCR clean up
From all samples that gave a single band after Gel electrophoresis, 10μl was aliquoted and added into a PCR tube followed by 2μl of ExoSAP IT. The samples were transferred into a thermocycler (Applied Biosystems, California, United States) and ran under the conditions: 370 C for 45 seconds, 800C for 45 seconds (inactivate ExoSAP-IT)2 and held at 40C.
5.10 Cycle sequencing
Sequencing was performed using an ABI version 3.1 BigDye Kit (Applied Biosystems, Catalogue no. 4337456) and ABI3500xl Genetic Analyzer. Briefly, a master mix was prepared as follows; 0.5μl Big Dye terminator, 1.75μl 5X sequencing buffer, 2.5 μl primer as shown in the primer map (Fig 5) and primer sequences are shown in table 5 below (18) and 4.25μl water. 9μl of sequencing master mix was added into each well where 1μl of DNA was added.
Briefly, PCR amplifications was subjected to thermal cycling as follows: 96°C for 1 minute; 30 cycles of denaturation at 96°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 68°C for 2.40 minutes; followed by 68°C for 7 min.
Table 5 Primers used in sequencing of the CCR5 promoter 1 region
Primer
|
Binding position
|
Forward F 5′CCAAGCACCAGCAATTAGC3′
|
58105 – 58122
|
Reverse R 5′TGCCACCACAGATGAATGTC3′
|
60293 – 60274
|
Forward IFS 5′TTGCTGTTTGGGGTCT3′
|
58471 – 58486
|
Forward F1 5′GAGTGGAGAAAAAGGGGG3′
|
59013 – 59030
|
Reverse R1 3′AGAATAGATCTCTGGTCTGAAA5′
|
59375 – 59354
|
Fig 5. The CCR5 promoter primer map for the primers used in sanger sequencing.
5.11 Data Analysis
Flow cytometry data were analyzed using FlowJo version 10.5.2 software. CD4+ T cells were distinguished by their surface expression of CD3 and CD4. Within these CD4+ T cells we identified CCR5+ T cells and determined both the percentage CD4+CCR5+ T cells and CCR5+ MFI (to ascertain the CCR5 density on CD4+ T cells). Statistical analysis was performed using GraphPad Prism 7. The Mann Whitney test for non-parametric variables facilitated comparison of differences among groups. P values < 0.05 indicated a significant difference.
Sanger Sequence data analysis was performed using mutation surveyor Mutation version 5.5 (SoftGenetics; Pennsylvania, USA). U95626 and NT_022517 reference sequences were used in assembly as used in other studies (18). A search of the GenBank NCBI SNP database (dbSNP) determined whether polymorphisms detected in this study had been previously reported. The CCR5 numbering system was used where the first nucleotide of the translational start site is designated as +1 and the nucleotide immediately upstream from that is −1 (41).