KIF21B acts as an oncogene in hepatocellular carcinoma through the NF- κB/p65 signaling pathway

doi:10.21203/rs.3.rs-2706578/v1

Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide. Its invasiveness and ability to metastasize contributes to an extremely high patient mortality. However, the molecular mechanisms that underlie the characteristics of HCC progression are not well understood. The kinesin superfamily 21 B (KIF21B) has been shown to be involved in hepatocellular carcinoma (HCC). Nevertheless, its role in HCC has not yet been thoroughly examined.

Tumor Genome Atlas (TCGA) was used to analyze the difference of KIF21B expression between HCC and normal tissues and its relationship with clinicopathological features. For further validation, immunohistochemistry (IHC) was used to detect the expression of KIF21B in 116 cases of liver cancer. In vitro studies, we used loss-of-function assays to evaluate the effects of KIF21B and its direct target NF-κB(nuclear factor-κB) p65 subunit on cell growth, proliferation, apoptosis, migration, invasion, and epithelial-mesenchymal transition (EMT).Then the effect of KIF21B inhibition on tumor growth was studied in nude mice in vivo.

We demonstrated that elevated KIF21B expression is associated with adverse clinicopathological features, such as tumor size, in HCC patients. In vitro experiments showed that silencing KIF21B could inhibit the proliferation, migration, invasion and EMT of HCC cells, and induce apoptosis, while overexpression of p65 could reverse these effects. In addition, silencing of KIF21B inhibited the growth of HCC in xenografts in nude mice.

In this study, we identified and validated that KIF21B plays a carcinogenic role in HCC through NF-κB/p65 signaling pathway, providing a new insight into HCC pathogenesis and therapeutic possibilities.

Hepatocellular carcinoma

Oncogene

KIF21B

NF-κB/p65 signaling pathway

Proliferation

Apoptosis

EMT

Hepatocellular carcinoma (HCC) has been diagnosed as the sixth most common cancer and the fourth leading cause of cancer-related death [1]. In 2015, there were 466,100 new cases and 422,100 deaths in China, accounting for 70%-90% of HCC [2]. In recent years, considerable progress has been made in the treatment of HCC, including surgery, radiofrequency/microwave ablation and interventional therapy. However, the 5-year survival rate of HCC remains less than 7% [3]. Therefore, there is an urgent need to better understand the mechanism of HCC occurrence and development to improve the clinical efficacy of HCC patients.

Kinesin superfamily proteins (KIFs), microtubule-based motor proteins, play a major role in cell mitosis, intracellular transport, cytoskeleton reorganization and participate in various processes of cell carcinogenesis [4]. Recent studies have shown that the abnormal expression of KIF (KIF3B, KIF4A, KIF23) is closely related to the occurrence, development and prognosis of HCC [5–7]. However, the role of KIF21B in HCC remains unclear and has only been shown to be associated with diseases closely associated with tumorigenesis, such as inflammatory bowel disease, multiple sclerosis, and neurodevelopmental disorders [8–11].

Ninety percent of HCC patients experience chronic hepatitis, fibrosis, and cirrhosis [12]. Inflammation is essential for development of HCC [13]. Related studies have shown that NF-κB (nuclear factor-kappa B) transcription factor family is extremely vital for inflammation process [14, 15], and further studies showed that NF-κB signaling participates in the modulation of immunity and cancer [16]. NF-κB is a dimer of the Rel protein, and often constitutes two subunits, RelA (p65) and NF-kappa B1 (p50). When cells are exposed to specific stimuli, the NF-κB dimer regulates the transcription of its target genes by interacting with inhibitory κB (IκB) proteins [17].

Many previous studies have shown that NF-κB, especially the p65 subunit, is important in the development of HCC [18, 19], and upregulation of p65 and enhancement of the NF-κB signal cascade promotes the progression of HCC. There have been several studies on the relationship between KIF and the NF-κB signaling cascade. For example, KIF2 induces neuroprotection in cerebral ischemia injury via affecting the NF-κB cascade [20]. However, the relationship between KIF21B, NF-κB, and HCC is not clear. Herein, we hypothesized that KIF21B may affect the initiation and progression of HCC by regulating the NF-κB signaling cascade. Therefore, we next evaluated HCC for the expression of KIF21B and p65. Our studies demonstrated that NF-κB/p65 signaling was the downstream pathway of KIF21B in HCC, and that KIF21B-mediated p65 expression promoted the development of HCC both in vitro and in vivo. Therefore, KIF21B is possible prognosis biomarker in HCC patients and could be a new treatment target for HCC patients.

2.1 Kif21B is overexpressed in HCC and is strongly linked to prognosis of HCC patients

In order to clarify KIF21B expression in HCC, we used HCC samples from the TCGA database. By analyzing data from 50 pairs of HCC tissues (659.90 ± 744.95) and matched non-malignant tissues (129.48 ± 139.76), the mRNA expression of KIF21B in HCC tissues was remarkably elevated in contrast with neighboring tissue (P < 0.01, Fig. 1A). We also conducted an IHC experiment by using 166 cases, which illustrated that KIF21B expression in HCC tissues (74/166, 36.8%) was remarkably higher relative to neighboring tissues (14/166, 12.1%) (P < 0.01, Fig. 1C). The KIF21B positive signal was located mostly in the cytoplasm.

The difference in KIF21B expression in tumors and neighboring cells was statistically significant, and was linked to the T stage and pathological stage of HCC (P < 0.01, Fig. 1B). We used RT-qPCR to analyze KIF21B expression in HCC and neighboring tissues in the 166 cases and listed the clinical features of the subjects (Table 1). Chi-square tests illustrated that elevated KIF21B expression was closely linked to tumor pathological tumor-node-metastasis (pTNM) staging, vascular invasion, and hepatitis B virus (HBsAg) infection (P < 0.05) (Table 1).

Table 1. Correlation between KIF21B expression and clinicopathological characteristics.

Characteristics	N	KIF21B expression		c2	P-value
Characteristics	N	Low	High	c2	P-value
Age (years)				2.733	0.098
≥57	60	26	34	2.733	0.098
<57	56	16	40
Gender				0.010	0.919
Male	67	24	43	0.010	0.919
Female	49	18	31
Tumor Seize (cm)				0.325	0.568
≥5	51	17	34	0.325	0.568
<5	65	25	40
Liver cirrhosis				0.394	0.530
Yes	43	14	29	0.394	0.530
No	73	28	45
TNM stage				5.078	0.024*
Ⅰ-Ⅱ	63	17	46	5.078	0.024*
Ⅲ-Ⅳ	53	25	28
HBsAg				8.936	0.003*
Yes	68	17	51	8.936	0.003*
No	48	25	23
AFP (ng/mL)				3.517	0.061
>400	64	28	36	3.517	0.061
≤ 400	52	14	38
Vascular invasion				8.094	0.004*
Yes	57	28	29	8.094	0.004*
No	59	14	45

*P<0.05. The P value calculated by person X² test. AFP: Alpha-fetoprotein.

We followed up the 166 HCC patients. Univariate analysis exhibited that tumor size (P = 0.011), serum AFP content (P = 0.015), and KIF21B expression (P = 0.010) were the main risk factors for the HCC patients' overall survival (OS)(Table 2). Multivariate analysis illustrated that tumor size (P = 0.023) and KIF21B expression (P = 0.021) were independent predictors of the OS rate of HCC patients (Table 2). Kaplan-Meier assessment exhibited that the median OS time of patients with elevated expression of KIF21B was remarkably less than that of patients in the low expression group (26m, 40m, P < 0.001, Fig. 1D), and the median disease-free survival time of patients with elevated expression of KIF21B was less than that that of patients in the low expression group (24m, 30m, P < 0.001, Fig. 1D). These data suggest that elevated KIF21B expression is linked to a poor prognosis for HCC patients.

Table 2

Univariate and multivariate analysis of overall survival in 116 patients with HCC.
Variables	Univariate analysis			Multivariate analysis
Variables	HR	95% CI	P-value	HR	95% CI	P-value
Age (years) ≥ 57 vs. <57	1.437	0.730–2.833	0.293
Gender Male vs. Female	0.796	0.439–1.441	0.450
Tumor size (cm) >5 vs. ≤5	2.216	1.202–4.087	0.011*	1.951	1.098–3.465	0.023*
Liver cirrhosis Yes vs. No	1.353	0.760–2.408	0.305
TNM stage Ⅲ-Ⅳ vs. Ⅰ-Ⅱ	1.209	0.664–2.208	0.534
HBV infection Yes vs. No	1.770	0.958–3.268	0.069
AFP (ng/mL) >400 vs. ≤ 400	2.237	1.130–4.274	0.015*	1.848	1.028–3.322	0.040*
Vascular invasion Yes vs. No	1.285	0.738–2.237	0.375
KIF21B expression High vs. low	2.283	1.222–4.255	0.010*	2.024	1.020–4.016	0.021*
*P < 0.05. The P value calculated by Cox analysis. AFP, Alpha-fetoprotein; HBV, Hepatitis B Virus; HCC, Hepatocellular carcinoma.

2.2 Silencing KIF21B in HCC cells can remarkably repress cell growth, proliferation, and colony formation

To study the biological role of KIF21B, we used shRNA-KIF21B-lentivirus to infect HCC cell lines and silence the expression of KIF21B. As indicated in Fig. 2A and 2B, the expression of KIF21B mRNA along with protein levels was remarkably decreased in BEL-7404, as well as Huh-7 cells. A Celigo Imaging Cytometer and MTT assays showed that KIF21B silencing repressed the growth and proliferation of BEL-7404 and Huh-7 cells (Fig. 2C, D, E). We also performed a clone formation experiment to evaluate the clone formation ability of BEL-7404, as well as Huh-7 cells after silencing KIF21B. As indicated in Fig. 2F, the results further valiadated that knocking down KIF21B repressed the colony forming potential of HCC cells.

2.3 Knockdown of KIF21B can promote apoptosis and suppress migration and invasion abilities of HCC cells.

After HCC cells had been infected with shKIF21B for 72 h, we used Annexin V-APC single staining flow cytometry to detect the apoptosis rate of HCC cells. In contrast with the shCtrl group, the apoptosis rate of the shKIF21B group was remarkably increased (Fig. 3A, B). Wound-healing assay showed that the migration surface of BEL-7404 and Huh-7 cells transfected with sh-KIF21B was significantly reduced compared with the NC group (Fig. 3C, D). In addition, transwell assay results showed that the number of migrated cells was significantly reduced after silencing KIF21B (Fig. 3E, F), which was further confirmed that shKIF21B inhibited HCC cell migration and invasion.

2.4 Silencing KIF21B inhibits EMT and activation of the NF-κB/p65 signaling pathway in HCC cells and suppresses xenograft growth in nude mice

To gain insight into the mechanism of KIF21B function, We detected the expression levels of EMT and NF-κB signaling pathway related proteins after KIF21B silencing. RT-qPCR and Western blot data exhibited that the expression of epithelial gene related to cell junctions, E-cadherin, with silenced KIF21B was remarkably increased, but two other critical mesenchymal proteins, N-cadherin and vimentin, were reduced (Fig. 4A, B, C). Additionally, p65, Bcl-2, Myc, and Cyclin D1 in BEL-7404 and Huh-7 cells with silenced KIF21B was remarkably reduced, while C-Caspase3 expression level increased (Fig. 4A, B, C). However, we did not observe that knockdown of KIF21B had a significant effect on p-p65 expression level in BEL-7404 and Huh-7 cells as indicated in Fig. 4B, C. On the basis of these data, we hypothesized that silencing KIF21B may inhibit EMT of HCC cells by regulating NF-κB/p65 signaling pathway; knocking down KIF21B may enhance apoptosis of HCC cells by regulating the expression of NF-κB/p65 and Bcl-2 and activating C-Caspase3; KIF21B may inhibit the growth and proliferation of HCC cells by modulating the expressions of NF-κB/p65, Myc, and Cyclin D1.

As the effect of KIF21B on HCC cells was confirmed by in vitro experiments, we further explored the effect of KIF21B on tumor growth in vivo. We subcutaneously injected Huh-7 cells treated with shCtrl and shKIF21B into BALB/c nude mice and removed the tumor at the end of the experiment (Fig. 4D). Tumor volume and weight in the shKIF21B group were remarkably lower in contrast with the control group (Fig. 4E, F).

2.5 NF-κB/p65 is required for KIF21B-mediated EMT

To verify whether KIF21B mediated EMT through NF-κB/p65 signaling cascade, we examined the effects of p65 overexpression in Huh-7-shKIF21B cells. RT-qPCR and Western blot assays showed that upregulation of p65 markedly increased the expression of N-cadherin and vimentin but downregulated the expression of E-cadherin (Fig. 5A,B,C). As anticipated, the reduced migration and invasion abilities observed in Huh-7-shKIF21B cells in Wound-Healing and Transwell assay were partially facilitated when p65 was upregulated (Fig. 5D,E). Taken together, these results demonstrated that p65 was required for the effects of KIF21B on EMT, migration and invasion.

2.6 Up-regulation of p65 can reverse effects of shKIF21B on growth, proliferation, colony formation and apoptosis of HCC cells

To explore whether KIF21B promotion of HCC depends on the NF-κB signaling cascade, we established the effects of p65 overexpression in BEL-7404-shKIF21B and Huh-7-shKIF21B cells. We performed a Celigo Imaging Cytometer and MTT analysis of HCC cells to explore if the re-expression of p65 could restore the proliferation effect of KIF21B on HCC cells. We silenced KIF21B in HCC cells and compared its effect on HCC with the overexpression of p65. Silencing KIF21B could effectively inhibit the growth and proliferation of HCC cells (Fig. 2C, D, E), but when the expression of p65 was restored in HCC cells with silenced KIF21B, the growth and proliferation were remarkably restored in BEL-7404 and Huh-7 cells (Fig. 6A, B, C, D). Then, we evaluated the effect of p65 on apoptosis in HCC cells. Our findings were consistent with those of the MTT analysis, showing that silencing KIF21B could promote apoptosis in BEL-7404, as well as Huh-7 cells (Fig. 3A,B). The overexpression of p65 reversed the increase in HCC cell apoptosis caused by downregulation of KIF21B in BEL-7404 and Huh-7 cells (Fig. 6E). Overall, these data indicated that p65 is the functional target of KIF21B, and that p65 is necessary for the oncogenic impacts of KIF21B to promote HCC cell growth, proliferation, and survival

Table 3. Quantitative Real-time PCR primers used in this study.

Gene name	Primer sequence (5’ to3’)	Amplicon size（bp）
KIF21B	F: GGATGCCACAGATGAGTT R: TGTCCCGTAACCAAGTTC	75
GAPDH	F:TGACTTCAACAGCGACACCCA R: CACCCTGTTGCTGTAGCCAAA	121
p65	F:GGCGAGAGGAGCACAGATAC R:ATCTTGAGCTCGGCAGTGTT	446
E-Cad	F:GAAGTGTCCGAGGACTTTGG R:CAGTGTCTCTCCAAATCCGATA	109
N-Cad	F:CCACCTTAAAATCTGCAGGC R:GTGCATGAAGGACAGCCTCT	100
Vimentin	F:TGTCCAAATCGATGTGGATGTTTC R:TTGTACCATTCTTCTGCCTCCTG	117
Bcl-2	F:GTCGCTACCGTCGTGACTTC R:CAGACATGCACCTACCCAGC	284
Cyclin D1	F:GGCGGATTGGAAATGAACTT R:TCCTCTCCAAAATGCCAGAG	109

HCC remains one of the most common malignant tumors globally, with high morbidity and mortality [21]. Due to the lack of typical symptoms in HCC patients, they are often diagnosed with middle or advanced HCC, often accompanied by continuous cell growth and metastasis [22]. The current options for treatment are limited. Hence, it is critical to identify novel, reliable targets for HCC therapy.

KIF plays a vital role during mitosis, and there is increasing evidence that KIF is involved in tumorigenesis [23–25] in malignancies, such as gastric cancer, non-small cell lung cancer (NSCLC), colorectal cancer, as well as breast cancer. Previous reports have shown that upregulation of KIF14 can enhance the progress of cancer and metastasis and produce poor prognoses for individuals with gastric and colorectal cancer [26, 27]. Gu et al. found that knocking down KIF26B could repress the growth and infiltration of breast cancer cells [28]. It has been reported that KIFC1 is also involved in the progress of NSCLC, by regulating cell proliferation along with the cell cycle [29]. Thus, a better comprehension of the association of KIF with tumor progression could unearth new insights into the mechanism of tumorigenesis and provide an effective target for cancer treatment. Herein, our data supported the hypothesis that KIF21B has a role in carcinogenesis in HCC. Recently, KIF21B was found to be upregulated in lung cancer tissues and cells lines, making it an independent risk factor for OS in patients with NSCLC [30]. Our findings illustrated that KIF21B was highly expressed in HCC tissues in contrast with neighboring non-malignant tissues, which is in agreement with the expression profile of KIF21B in lung cancer. Elevated KIF21B expression was linked to vascular invasion and tumor stage and a dismal prognosis for individuals with HCC. On the basis of these findings, KIF21B may be a promising clinical prognostic biomarker of HCC and may participate in the initiation and progression of HCC.

Uncontrolled proliferation is the main feature of malignant tumors. Gu et al. have shown that the downregulation of KIF26B can regulate the proliferation of breast cancer cells by regulating CyclinD1 [28]. Liu et al. demonstrated that knocking down KIFC1 can decrease the proliferation of lung cancer A549 and SPC-A1 cells and induce G2/M phase arrest [29]. It has been documented recently that the KIF21B silencing enhances decreased proliferation in H1299 and A549 cells [30]. Herein, loss-of-function experiments showed that knocking down KIF21B repressed the growth of BEL-7404 and Huh-7 cells and suppressed the growth of HCC in vivo, findings which are in agreement with the promotion of proliferation induced by KIF21B in lung cancer cells. We reported a remarkable increase in the apoptosis rate of HCC cells after silencing KIF21B. The Bcl-2 family is the key regulator of the intrinsic apoptosis cascade. Bcl-2/Bax is the key regulator that determines the fate of cells [31]. Caspase 3 is another crucial player in the process of apoptosis [32]. We established that the expression of the anti-apoptotic protein Bcl-2 was remarkably downregulated after silencing KIF21B, whereas the expression of the pro-apoptotic protein Bax and active Caspase-3 was upregulated. These data suggest that downregulation of KIF21B might enhance the apoptosis of HCC cells by regulating the activation of the Bcl-2/Bax cascade and Caspase-3. These data suggest that KIF21B plays a carcinogenic role in the apoptosis of HCC cells, and the regulatory action of KIF21B on apoptosis may be related to its regulation of the growth of HCC cells.

NF-κB is one of the most complex transcription factors [33], with five subunits, RelA/p65, RelB, C-Rel, p50 (p105/NF-κB1), and p52 (p100/NF-κB2), and an upstream-activated kinase complex (IKKa, IKKb, and IKKc). And combinations of the structure and regulation of these factors may produce considerable variability in their physiological function. NF-κB is generally considered to be a pre-survival and pre-inflammatory transcription factor that promotes the development of cancer. We established that elevated expression of KIF21B was related to hepatitis B virus infection, one of the main causes of hepatitis, and NF-κB/p65 transcription factors play a vital role in the process of inflammation [14]. Therefore, we speculate that KIF21B may mediate the occurrence of hepatitis B by regulating the NF-κB/p65 signaling cascade. This hypothesis will have to be investigated in further follow-up studies. NF-κB is also heavily involved in the modulation of initiation, proliferation, and metastasis of breast cancer [34]. Further phosphorylation of NF-κB subunits (such as p65) may also affect the specificity of gene transcription. A recent study identified another mechanism of drug resistance, in which small HER2 inhibitors such as lapatinib may enhance p65 phosphorylation at Ser529 through CKII, thereby enhancing the transcription of NF-κB to confer resistance [35]. We established that the expression of p65, cyclin D1, and Myc protein were remarkably downregulated after silencing KIF21B, while the rescue test showed that the expression of cyclin D1 and Myc protein was upregulated after upregulation of p65, and that this upregulation restored the promoting influence of KIF21B on the growth, proliferation, and survival of HCC cells. Therefore, these data showed that KIF21B upregulated the expression of p65 to enhance the expression of the NF-κB signaling cascade in HCC cells, hence influencing the proliferation along with the apoptosis of HCC. Studies by Gu et al. have shown that KIF26B may disrupt the transforming growth factor (TGF)-β signal transduction pathway of transferrin growth factor and contribute to the development of breast cancer [28]. These data indicate an active role for KIF in complex signaling cascades, including phosphatidylinositol-4-diphosphate 3-kinase (PI3K)/Akt, TGF-β, Wnt/β-catenin, MAPK. These results support the contention that KIF21B functions as an HCC oncogene in vivo and in vitro. KIF21B can be used as a new therapeutic target for HCC therapy, although further research will be necessary to study the related molecular signal transduction pathway.

Metastasis is an important cause for poor prognosis of cancer patients. Our results showed that KIF21B expression was markedly linked to vascular invasion in HCC patients, suggesting that KIF21B may affect the migration and invasion of HCC. Recently, Sun et al. found that silencing KIF21B could reduce the migration along with invasion of the NSCLC cell lines H1299 and A549, indicating a possible role of KIF21B in the regulation of tumor metastasis [30].It has been verified that KIF26B modulates the infiltration of breast cancer cells by driving EMT [28]. Our experiments showed that the migration, invasion and EMT process of HCC cells were inhibited after silencing KIF21B. In addition, we further confirmed that silencing KIF21B down-regulated p65 expression in HCC, and overexpression of p65 in Huh-7-shKIF21B cells reversed the changes of EMT markers and the inhibition of migration and invasion caused by shKIF21B, confirming that p65 is necessary for KIF21B-mediated EMT process and HCC progression. In this context, the regulation of p65 by KIF21B is a novel mechanism identified in this report, but the direct regulation mechanism of NF-κB/p65 by KIF21B remains unclear and requires our further study in the future.

4.1 Clinical specimens

We collected tumor specimens and matched non-malignant neighboring tissues from 116 HCC patients at Gansu Provincial Hospital from March 2014 to March 2019. Histology was assessed by two independent pathologists. None of 116 HCC patients received tumor-specific therapy prior to surgery. HCC tissues and neighboring non-malignant tissues were obtained, fixed with 10% formaldehyde solution, and embedded in paraffin wax. Use of patient specimens was approved by the Ethics Committee of Gansu Provincial Hospital (Approval No. 2019–063). Patients characteristics are listed in Table 1.

4.2 In Silico analysis using the Cancer Genome Atlas (TCGA) dataset

To compare the KIF21B expression profile with the clinicopathologic features in HCC, 50 HCC patients with cancer and matched neighboring non-malignant tissues of TCGA data was retrieved from http://cancergenome.nih.gov/. Data extraction was performed using R 3.1.2.

4.3 Cell culture and transfection

Huh-7 and BEL-7404 human HCC cell lines were provided by Shanghai cell collection (Shanghai, China). They were grown in RPMI-1640 medium enriched with 10% FBS, 0.1 mg/mL streptomycin, as well as 100U/mL penicillin (All form Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) under 37°C and 5% CO2 conditions. Afterwards, they were inserted for 24 h with two lentiviral constructs, short hairpin RNA (shRNA) targeting the KIF21B gene (shKIF21B) and control shRNA (shCtrl) generated by Shanghai Gene Chemical Co., Ltd (Shanghai, China) via transfection. The cDNA encoding the p65 gene was subcloned into the pCDNA3 vector to generate the recombinant vector pCDNA3-p65. Green fluorescence was employed to determine the efficiency of transfection. Stable cell lines were screened for 10 days at 0.5 µg/mL puromycin. The target sequences of KIF21B were as follows: shKIF21B#1: 5'-GGAGCTGATGGAGTATAAG-3'; shKIF21B#2: 5'-GGGCTATAGTGATCTGTTCCG-3'; the shCtrl sequence was as follows: 5'-TTCTCCGAACGTGTCACGT-3'.

4.4 RT-qPCR analysis

RNA extraction kits (Shanghai Pufei Biotech Co., Ltd,) were employed to isolate total cellular RNA. Reverse transcription was carried out using HiFiScript cDNA Synthesis Kits (CWBIO, Beijing, China). The expression of KIF21B mRNA was assayed using a SYBR Premix Ex Taq II kit (Takara, Kyoto, Japan). The 2-∆∆Ct approach was employed to analyze the data. GAPDH was employed as an internal standard for the quantification. The primers for KIF21B were 5′- GGATGCCACAGATGAGTT − 3′ (forward) and 5′- TGTCCCGTAACCAAGTTC − 3′ (reverse); and primers for GAPDH were 5′- TGACTTCAACAGCGACACCCA − 3′ (forward) and 5′- CACCCTGTTGCTGTAGCCAAA − 3′ (reverse). Primer sequences are shown in Table 3. The primers used in this study were synthesized by Shanghai GeneChem Co., Ltd.

4.5 Western blot analysis

After 72 h of cell infection, the RIPA buffer (Beyotime, China) was employed to isolate the total cellular proteins. Then, as described by the manufacturer, the BCA kit (Beyotime, China) was employed to determine protein concentration. Next, protein samples were fractionated on 10% SDS-PAGE gels, followed by blotting onto a PVDF membranes. After that, 5% fat-free milk was employed to block the proteins, and then inoculated with 1:250 dilution of the corresponding primary antibody and incubated overnight at 4°C. After washing, they were inoculated for 1 h with HRP-labelled secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) (1:1000 dilution). The expression of target protein was analyzed by chemiluminescence chromogenic assay and ImageJ software (NIH, Bethesda, MD, USA).

4.6 Cell growth assay

Three days after lentivirus infection with shRNA, cells (2,000 cells per well) were inoculated into a 96-well plate, and incubated for five days. From the second day, a Celigo Imaging Cytometer (Biotek, USA) continuously detected the plate for 5 days, and accurately scanned the number of green fluorescent cells as an indicator of cell proliferation rate.

4.7 MTT assay

The MTT assay was employed to explore cell viability. Cells were inoculated into 96-well plates in triplicate. Then, MTT (5 mg/mL) was introduced to each well (20 µL) and incubated at 37°C for 4 h. Next, 100 µL of dimethyl sulfoxide (DMSO, Shanghai, China) was introduced to each well. Cell-growth ratios were detected by a MTT colorimetric assay after incubation for one, two, three, four, and five days. Finally, an enzyme-linked immunosorbent assay plate reader was employed to read the absorbance at 490 nm.

4.8 Apoptosis analysis

Cells were collected and re-suspended in PBS for 48 h after transfection at 3000 cells/mL. According to the instructions of AnnexinV-APC/PI Apoptosis Detection kit (eBioscience, Shanghai, China), cells were suspended in 300 µL of binding buffer and stained at room temperature (RT) for 20-30min in the dark to flow cytometry (eBioscience, Shanghai, China).

4.9 Colony formation assay

We performed colony formation assays to assess silencing KIF21B on HCC cell growth. Cells transfected with shRNA-KIF21B or shCtrl lentivirus (200 cells/well) were planted into six-well plates, and grown at 37°C for one to two weeks. After that, they were fixed with 4% paraformaldehyde for 30 min, followed by staining with 0.1% crystal violet. Finally, a dissecting microscope was employed to count colony numbers, and the cells were imaged.

4.10 Wound-healing assay

After 24 hours infection, cells (5 × 105 cells/well) were cultured in 6-well plates until confluent, and a wound was generated using a pipette tip. Wound closure was measured at 0 and 24 h after scratching.

4.11 Transwell assay

Cell invasion was assessed using Transwell chambers (Millipore) coated with Matrigel. We added 1 × 105 lentivirus-infected cells in the upper chamber; the lower chamber was supplemented with medium containing FBS. After incubation for 24 h, we wiped the cells that did not pass through the membrane with a cotton swab. We fixed migrated cells in methanol for 10 min and absorbed them with 0.25% crystal violet. Cultured cells were counted in five random microscope felds.

4.12 Immunohistochemistry (IHC)

Slices of each sample (5 µm thick) were mounted on glass slides, dewaxed, dehydrated, and boiled in 10 mmol/L citrate buffer to recover antigens. After incubation with methanol enriched with 0.3% H2O2 for 10 min to repress the activity of endogenous peroxidase, the we sealed the sections with 2% BSA for 30 min. Afterwards, the sections were inoculated with polyclonal rabbit-human KIF21B antibody and incubated overnight at 4°C (1:200; Bioss, Beijing, China). Thereafter, they were rinsed thrice with PBS, the slides were inoculated with goat anti-mouse IgG conjugated to horseradish peroxidase for 30 min, reacted with diaminobenzidine, and re-stained with hematoxylin. KIF21B expression was assessed by two independent pathologists. The staining results were evaluated by considering both the proportion of positive cells along with the intensity of staining. The proportion of positive stained cells were estimated as follows: 0 (< 10%), 1 (10–25%), 2 (25–50%), 3 (50–70%), and 4 (> 70%). The intensity of staining was 3 (strong staining), 2 (moderate staining), 1 (weak staining) and 0 (no staining). According to the immunoreactive score = staining intensity × percentage of positive cells, and score was between 0 and 12. A total score of more than 5 was considered to indicate elevated expression

4.13 Immunofluorescence.

Treated gastric cancer cells were fixed with methanol. After several rinses with PBS, the cells were permeabilized with 0.2% Triton X-100 for 5 min. The permeabilized cells were subsequently blocked with 0.1% BSA and incubated overnight with primary antibody at 4°C and then incubated with secondary antibodies (Invitrogen) for 1 h. Finally, the cells were incubated with DAPI (Sigma-Aldrich) for 5 min and viewed with a Fluoview IX71 microscope (Olympus, Tokyo, Japan).

4.14 In vivo tumorigenic assay

Twenty four- to six-week-old female BALB/c-nude mice (Vital River Inc., Beijing, China) were grouped randomly into two groups (n = 10/per group); NC group and KD group. Huh-7 cells transfected with shCtrl or shKIF21B were suspended in PBS. An equipartition sample of 3×106 cells/100 µL PBS was administered subcutaneously into the right flanks of the mice. The size of the tumor was recorded every seven days with a caliper, and the volume (V) was determined using the formula: V = (L×W2)/2, where L is the largest diameter (mm), and W is the smallest diameter (mm). After 35 days, the mice were scarificed, and the weight of the tumor was recorded. An animal protocol was approved by the Animal Care and Use Committee of the Gansu Provincial Hospital (Approval No. 2019–063).

4.15 Statistical analyses

Statistical analyses were carried out using GraphPad Prism V.6 (GraphPad Software) and SPSS (V.22, IBM). Comparisons of quantitative and categorical variables between the two groups were performed using two-sided Student's t-tests and Chi-squared tests, respectively. The Kaplan-Meier approach with the log-rank test was implemented to plot the survival curves. The Cox proportional hazards model was employed to determine the prognostic factors. Data are given as mean ± standard deviation (SD). All samples were tested in triplicate. P < 0.05 signified statistical significance. NS, not significant (P > 0.05), * signified P < 0.05, ** signified P < 0.01, *** signified P < 0.001.

This study showed that the expression of KIF21B was up-regulated in HCC tissues, and the increased expression of KIF21B was associated with adverse clinicopathological features, and the increased level of KIF21b predicted poor prognosis of HCC patients. Our data demonstrate that KIF21B plays an important role in HCC development by regulating the NF-κB/p65 signaling cascade, and silencing KIF21B inhibits HCC cell proliferation, migration, invasion, EMT, and induces apoptosis (Fig. 7). Therefore, this study demonstrates that targeting the KIF21B-NF-κB/p65 axis is a promising novel approach for HCC treatment.

KIF21B:The kinesin superfamily 21 B;HCC:hepatocellular carcinoma ;TCGA: The Cancer Genome Atlas;IHC: immunohistochemistry; NF-κB :nuclear factor-κB;EMT:epithelial-mesenchymal transition;KIFs:Kinesin superfamily proteins;pTNM: pathological tumor-node-metastasis;OS:overall survival;NSCLC:non-small cell lung cancer;TGF:transforming growth PI3K:factor;phosphatidylinositol-4-diphosphate 3-kinase;shRNA:short hairpin RNA;shCtrl:control shRNA;DMSO:dimethyl sulfoxide;RT:room temperature.

Acknowledgements: We gratefully acknowledge the help and support from the general surgery clinical medicine center of Gansu Provincial Hospital, the general surgery clinical quality control center of Gansu Provincial Hospital and Gansu Key Laboratory of Molecular Diagnostics and Precision Medicine for Surgical Oncology, Gansu Provincial Hospital.

Authors’ contributions: conceptualization, SY.C. and XH.D.; Data curation, ZJ.Y. and XX.W.; Formal analysis, SY.C. and JH.C.; Investigation, BL.D.; Methodology, XH.D.; Project administration, BL.D. and CN.L.; Resources, P.G.; Software, SY.C. ; Supervision, P.G. and XJ.Y.; Visualization, SY.C.; Writing—original draft, SY.C., XH.D. and JH.C.; Writing—review& editing, H.C. and XJ.Y. All authors read and approved the final manuscript.

Funding: This study was supported by Key Projects of the National Scientific Research Cultivation Program, No.2019-2162; The Central Guidance on Local Science and Technology Development Fund of Gansu Province 2021；Innovation Base and Talent Project of Gansu Province, No.20JR10RA4333; Key R & D Projects of the Provincial Science and Technology Program of Gansu Province, No.21YF5WA0274; Scientific Research Program of the Health Industry of Gansu Province, No.GSWSKY2020-45. And the fundings can support the publication of this manuscript.

Availability of data and materials

The data during and/or analyzed during the current study available from the corresponding author on reasonable request.

Ethics approval and consent to participate: The studies involving human participants were reviewed and approved by the Ethics Committee of Gansu Provincial Hospital (Approval No. 2019–063). The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by the Animal Care and Use Committee of the Gansu Provincial Hospital.

Consent for publication:

Not applicable.

Conflicts of Interest: The authors declare no conflict of interest.

Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018, 68:394-424. doi: 10.3322/caac.21492
Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66(2):115-132. doi:10.3322/caac.21338
Kim JH, Kim JW, Seo JW, et al. Noninvasive Tests for Fibrosis Predict 5-Year Mortality and Hepatocellular Carcinoma in Patients With Chronic Hepatitis B. J Clin Gastroenterol 2016, 50:882-888. doi: 10.1097/MCG.0000000000000574
Shantanu PA, Sharma D, Sharma M, et al. Kinesins: Motor Proteins as Novel Target for the Treatment of Chronic Pain. Mol Neurobiol 2019, 56:3854-3864. doi: 10.1007/s12035-018-1327-y
Huang X, Liu F, Zhu C, et al. Suppression of KIF3B expression inhibits human hepatocellular carcinoma proliferation. Dig Dis Sci 2014, 59:795-806. doi: 10.1007/s10620-013-2969-2
Sun X, Jin Z, Song X, et al. Evaluation of KIF23 variant 1 expression and relevance as a novel prognostic factor in patients with hepatocellular carcinoma. BMC Cancer 2015, 15:961. doi: 10.1186/s12885-015-1987-1
Huang Y, Wang H, Lian Y, et al. Upregulation of kinesin family member 4A enhanced cell proliferation via activation of Akt signaling and predicted a poor prognosis in hepatocellular carcinoma. Cell Death Dis 2018, 9:141. doi: 10.1038/s41419-017-0114-4
Muhia M, Thies E, Labonte D, et al. The Kinesin KIF21B Regulates Microtubule Dynamics and Is Essential for Neuronal Morphology, Synapse Function, and Learning and Memory. Cell Rep 2016, 15:968-977. doi: 10.1016/j.celrep.2016.03.086
Goris A, Boonen S, D'Hooghe M B, et al. Replication of KIF21B as a susceptibility locus for multiple sclerosis. J Med Genet 2010, 47:775-6. doi: 10.1136/jmg.2009.075911
Asselin L, Rivera Alvarez J, Heide S, et al. Mutations in the KIF21B kinesin gene cause neurodevelopmental disorders through imbalanced canonical motor activity. Nat Commun 2020, 11:2441. doi: 10.1038/s41467-020-16294-6
Zhao HQ, Dong BL, Zhang M, et al. Increased KIF21B expression is a potential prognostic biomarker in hepatocellular carcinoma. World J Gastrointest Oncol 2020, 12:276-288. doi: 10.4251/wjgo.v12.i3.276
Ringelhan M, Pfister D, O'Connor T, et al. The immunology of hepatocellular carcinoma. Nat Immunol 2018, 19:222-232. doi: 10.1038/s41590-018-0044-z
Llovet JM, Zucman-Rossi J, Pikarsky E, et al. Hepatocellular carcinoma. Nat Rev Dis Primers 2016, 2:16018. doi: 10.1038/nrdp.2016.18
Hoesel B, and Schmid JA. The complexity of NF-kappaB signaling in inflammation and cancer. Mol Cancer 2013, 12:86. doi: 10.1186/1476-4598-12-86
Muxel SM, Laranjeira-Silva MF, Carvalho-Sousa CE, et al. The RelA/cRel nuclear factor-kappaB (NF-kappaB) dimer, crucial for inflammation resolution, mediates the transcription of the key enzyme in melatonin synthesis in RAW 264.7 macrophages. J Pineal Res 2016, 60:394-404. doi: 10.1111/jpi.12321
Taniguchi K, and Karin M. NF-kappaB, inflammation, immunity and cancer: coming of age. Nat Rev Immunol 2018, 18:309-324. doi: 10.1038/nri.2017.142
Li F, Zhang J, Arfuso F, et al. NF-kappaB in cancer therapy. Arch Toxicol 2015, 89:711-31. doi: 10.1007/s00204-015-1470-4
Liu X, Tian S, Liu M, et al. Wogonin inhibits the proliferation and invasion, and induces the apoptosis of HepG2 and Bel7402 HCC cells through NFkappaB/Bcl-2, EGFR and EGFR downstream ERK/AKT signaling. Int J Mol Med 2016, 38:1250-6. doi: 10.3892/ijmm.2016.2700
Yang Q, Zhang J, Xu S, et al. Knockdown of PHF5A Inhibits Migration and Invasion of HCC Cells via Downregulating NF-kappaB Signaling. Biomed Res Int 2019, 2019:1621854. doi: 10.1155/2019/1621854
Wang J, Chen J, Chen J, et al. KIF2 mediates the neuroprotection in cerebral ischaemia injury by affecting NF-kappaB pathway. Clin Exp Pharmacol Physiol 2020, 47:274-280. doi: 10.1111/1440-1681.13175
Guo P, He Y, Chen L, et al. Cytosolic phospholipase A2alpha modulates cell-matrix adhesion via the FAK/paxillin pathway in hepatocellular carcinoma. Cancer Biol Med 2019, 16:377-390. doi: 10.20892/j.issn.2095-3941.2018.0386
Cauchy F, Fuks D, and Belghiti J. HCC: current surgical treatment concepts. Langenbecks Arch Surg 2012, 397:681-95. doi: 10.1007/s00423-012-0911-2
Huszar D, Theoclitou ME, Skolnik J, et al. Kinesin motor proteins as targets for cancer therapy. Cancer Metastasis Rev 2009, 28:197-208. doi: 10.1007/s10555-009-9185-8
Zhao P, Lan F, Zhang H, et al. Down-regulation of KIF2A inhibits gastric cancer cell invasion via suppressing MT1-MMP. Clin Exp Pharmacol Physiol 2018, 45:1010-1018. doi: 10.1111/1440-1681.12974
Lucanus AJ, and Yip GW. Kinesin superfamily: roles in breast cancer, patient prognosis and therapeutics. Oncogene 2018, 37:833-838. doi: 10.1038/onc.2017.406
Yang Z, Li C, Yan C, et al. KIF14 promotes tumor progression and metastasis and is an independent predictor of poor prognosis in human gastric cancer. Biochim Biophys Acta Mol Basis Dis 2019, 1865:181-192. doi: 10.1016/j.bbadis.2018.10.039
Wang ZZ, Yang J, Jiang BH, et al. KIF14 promotes cell proliferation via activation of Akt and is directly targeted by miR-200c in colorectal cancer. Int J Oncol 2018, 53:1939-1952. doi: 10.3892/ijo.2018.4546
Gu S, Liang H, Qi D, et al. Knockdown of KIF26B inhibits breast cancer cell proliferation, migration, and invasion. Onco Targets Ther 2018, 11:3195-3203. doi: 10.2147/OTT.S163346
Liu Y, Zhan P, Zhou Z, et al. The overexpression of KIFC1 was associated with the proliferation and prognosis of non-small cell lung cancer. J Thorac Dis 2016, 8:2911-2923. doi: 10.21037/jtd.2016.10.67
Sun ZG, Pan F, Shao JB, et al. Kinesin superfamily protein 21B acts as an oncogene in non-small cell lung cancer. Cancer Cell Int 2020, 20:233. doi: 10.1186/s12935-020-01323-7
Liu G, Pei F, Yang F, et al. Role of Autophagy and Apoptosis in Non-Small-Cell Lung Cancer. Int J Mol Sci 2017, 18. doi: 10.3390/ijms18020367
Zheng L, Zheng J, Wu LJ, et al. Julibroside J8-induced HeLa cell apoptosis through caspase pathway. J Asian Nat Prod Res 2006, 8:457-65. doi: 10.1080/10286020500173309
Zhang L, Zhao J, Gurkar A, et al. Methods to Quantify the NF-kappaB Pathway During Senescence. Methods Mol Biol 2019, 1896:231-250. doi: 10.1007/978-1-4939-8931-7_18
Ling J, and Kumar R. Crosstalk between NFkB and glucocorticoid signaling: a potential target of breast cancer therapy. Cancer Lett 2012, 322:119-26. doi: 10.1016/j.canlet.2012.02.033
Xia W, Bacus S, Husain I, et al. Resistance to ErbB2 tyrosine kinase inhibitors in breast cancer is mediated by calcium-dependent activation of RelA. Mol Cancer Ther 2010, 9:292-9. doi: 10.1158/1535-7163.MCT-09-1041

No competing interests reported.

WBoriginalphoto.zip

KIF21B acts as an oncogene in hepatocellular carcinoma through the NF- κB/p65 signaling pathway

Status:

Version 1

Abstract

Figures

1. Introduction

2. Results

2.1 Kif21B is overexpressed in HCC and is strongly linked to prognosis of HCC patients

2.2 Silencing KIF21B in HCC cells can remarkably repress cell growth, proliferation, and colony formation

2.3 Knockdown of KIF21B can promote apoptosis and suppress migration and invasion abilities of HCC cells.

2.5 NF-κB/p65 is required for KIF21B-mediated EMT

3. Discussion

4. Materials And Methods

4.1 Clinical specimens

4.2 In Silico analysis using the Cancer Genome Atlas (TCGA) dataset

4.3 Cell culture and transfection

4.4 RT-qPCR analysis

4.5 Western blot analysis

4.6 Cell growth assay

4.7 MTT assay

4.8 Apoptosis analysis

4.9 Colony formation assay

5. Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1