TET2 amplifies RIPK3/MLKL necroptosis signal by upregulation of PLK3 to promote UVB-induced skin photodamage

doi:10.21203/rs.3.rs-2709268/v1

Download PDF

Article

TET2 amplifies RIPK3/MLKL necroptosis signal by upregulation of PLK3 to promote UVB-induced skin photodamage

https://doi.org/10.21203/rs.3.rs-2709268/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The ultraviolet B (UVB) radiation causes cell death, reactive oxygen species (ROS) accumulation and skin inflammation, which leads to skin photodamage, including skin photoaging, photodermatoses, pigmentary disorders or even skin cancers. However, the mechanism of UVB-induced skin damage remains poorly understood. Here, we find that the expression of ten-eleven translocation 2 (TET2) is upregulated in UVB-irradiated cells and skin tissue. This upregulation leads to increased accumulation of reactive oxygen species (ROS) and cell death, as well as the release of matrix metalloproteinase-1 (MMP-1) and interleukin 6 (IL-6), which accelerates necroinflammation in UVB-irradiated mouse skin. Moreover, the study found that TET2 promotes skin photodamage induced by UVB by upregulating the protein kinase 3 (RIPK3)-mixed lineage kinase domain-like (MLKL) related necroptosis. Mechanistically, TET2 interacts with RIPK3 and MLKL via upregulated polo-like kinase 3 (PLK3), which leads to increased activation of the RIPK3/MLKL/necroptosis signal. These findings have important implications for the prevention and treatment of skin diseases caused by UVB irradiation. By better understanding the mechanisms underlying UVB-induced skin damage, researchers and clinicians may be better equipped to develop strategies for protecting against or treating these conditions.

Health sciences/Diseases/Immunological disorders

Biological sciences/Cell biology

UVB

skin photodamage

TET2

necroptosis

PLK3

Skin, mainly consist of the keratinocytes, is the largest organ of the body. It against the harmful environmental factors including ultraviolet rays (UVR) irradiation(1). UVR commonly divided into ultraviolet radiation A (UVA, 320 ~ 400 nm), ultraviolet radiation B (UVB, 290 ~ 320 nm) and ultraviolet radiation C (UVC, 200 ~ 275nm) (2). UVB exposure induces DNA damage, cell apoptosis, increases intracellular reactive oxygen species (ROS), thus ending in skin inflammation and photodamage (3). UVB radiation increased the release of matrix metalloproteinase (MMPs), causes degradation of collagen fibers, induces abnormal proliferation of melanin, DNA damage and immune suppression. Chronically UVB exposure initiates or aggravates photodermatoses like chronic actinic dermatitis, pigmentary disorders such as melasma, vitiligo and lichen planus pigmentosus, skin inflammatory disorders like rosacea, acne, atopic dermatitis and psoriasis, or even photoaging and skin cancers (4, 5). Taken into account, it is urgent and meaningful to explore the underlying mechanism of UVB-induced photodamage and find efficient methods or drugs to prevent individuals from photodamage.

Ten-eleven translocation 2 (TET2), a DNA dioxygenase that oxidizes the methyl group of 5-methylcytosine (5mC), regulates cellular function and differentiation potential, which has been proved to be an important regulator for normal hematopoiesis, immune homeostasis and hair-specific differentiation program (6, 7). A previous study revealed that TETs might play a dominant role in skin cells (8). Recent study described that TET2 defect associated with autoimmune lymphoproliferative phenotype (ALPS-like syndromes), which predominantly corresponds to phenocopy of autoimmunity (9). TET2 also has been found to promote systemic lupus erythematosus (SLE) via an IL-21‐TET2‐AIM2‐c‐MAF pathway. Mechanistically, TET2 mediates demethylation of AIM2, which may be responsible for increased T follicular helper cell differentiation and enhancing SLE pathogenesis (10). Role of TET2 in responsible for reducing melanoma initiation and progression, regulating the stem cells function of psoriasis were also demonstrated (11, 12). These findings provided new insights into the crosstalk between TET2 and skin inflammation or chronic skin diseases. Our previous research suggested that the expression levels of TET family members especially TET2 were significantly upregulated in UVB-irradiated HaCaT cells. This indicated that TET2 might be one of the potential molecular mechanisms in the development of UVB-induced skin photodamage. However, the role and specific mechanism of TET2 in UVB-induced skin photodamage remains unclear.

In this work, we show that the expression of TET2 is significantly upregulated in UVB-irradiated cells and skin. In addition, necroptosis is an important non-apoptotic regulated cell death (RCD) mechanism in TET2 mediated, UVB induced skin photodamage. Utilizing flow cytometry, RNA-seq, bioinformatics analysis and mouse model, the role of TET2 in regulating RIPK3-MLKL signaling, and, as a result, contributing to UVB-induced cutaneous photodamage was revealed. Moreover, polo like kinase 3 (PLK3), a key gene that connect TET2 and RIPK3-MLKL signaling in UVB-induced skin photodamage were explored. In conclusion, our results identified necroptosis as an important mechanism of UVB-induced skin damage, suggesting that TET2 may contribute to the pathogenesis of UVB-related skin diseases.

2.1 antibodies and reagents

Lipofectamine 2000 Transfection Reagent was obtained from ThermoFisher Scientific. Antibodies against RIPK3 (17563-1-AP), MLKL (21066-1-AP) were obtained from Proteintech; pho-RIPK3 (ab209384), pho-MLKL (ab187091) were from abcam; PLK3 (DF4471) was from Affinity; MMP-1 (bs-4597R) was from Bioss; IL-6 (GB11117) was from Servicebio. Inhibitors Necrosulfonamide (NSA), MCC950, GSK-872, Bobcat339 hydrochloride, z-VAD-fmk (ZVF) and Ferrostatin-1 (Fer-1) were purchased from Selleck.

2.2 Cell culture

The human keratinocyte (HaCaT) cell line (TCH-C388) and Monoclonal HaCaT cell line overexpressing TET2 by stable transfection (TET2 OE) were obtained from Cas9X™ company (https://www.cas9x.com, Suzhou, China). Cells were cultured in DMEM medium (C3113-0500, Vivacell Biosciences) supplemented with 10% FBS (Excell; FSP500) and 1% 10 kU/ml penicillin/10 mg/ml streptomycin (Procell; PB180120) at 37 ̊C with 5% CO2 in a humidified incubator. Cells from generations 3 to 4 were utilized for subsequent experiments.

2.3 Ultraviolet B irradiation

HaCaT and TET2 OE cells were plated on petri dishes. The medium was discarded once the cell confluence reached about 80%. After washing three times with phosphate-buffered saline (PBS; Procell), cells were covered with a thin layer of PBS and irradiated with Ultraviolet Irradiator SS-03B (Shanghai Sigma High-tech Co., Ltd., China) at 120 mJ/cm² does of UVB (280–320 nm). And then, the cells were covered with new complete medium for subsequent experiments.

2.4 Animal models of skin photodamage and treatment with inhibitors

All experimental protocols were approved by the Institutional Animal Use and Care Committee, Central South University. Eight-week-old BALB/C female mice were purchased from the Hunan SJA Laboratory Animal Co., Ltd (Hunan, China). Keratinocyte TET2 deficiency specifically mice, TET2 flox/flox k14-cre mice were obtained from Shanghai Model Organisms Center, Inc. (https://www.modelorg.com). A pathogen-free environment with a temperature of 25 ± 2°C and a relative humidity of 50%, twelve hours of daylight and twelve hours of total darkness were used to feed these mice. To establish the model of skin photodamage, the mice were irradiated with UVB every other day for 8 weeks, and all treatments were administered to the dorsal skin of the mice 30 min before UVB irradiation. The mice were randomly divided into five groups, namely Normal, vehicle (DMSO solute in saline)-treated plus UVB-irradiated, UVB-irradiated plus Bobcat 339 (1mg/kg), UVB-irradiated plus GSK-872 (1mg/kg) and UVB-irradiated plus NSA (0.01mg/ml)-treated groups. Each group had at least 5 mice. The UVB-irradiated mice were treated with 300mJ/cm² UVB every other day for 8 weeks. Furthermore, the vehicle-treated plus UVB-irradiated mice were subcutaneous injected with 200 µl vehicle (1% DMSO, diluted with saline water) and the inhibitor-treated mice were subcutaneously administered an equal volume of saline water containing of the corresponding inhibitors 30 min before UVB-irradiation once every other day. The Normal mice remained untreated. The mice were killed after the experiment, and the dorsal skin was removed for histological analysis.

2.5 Histopathological Evaluation and Immunohistochemistry

The skin samples were embedded in paraffin, preserved in 10% formalin and sectioned at 5 µm. These antibodies were used to stain the paraffin sections: MMP-1, IL-6, RIPK3, MLKL, PLK3, TET2. Histopathology was examined through microscopy and the positive rate of these indicators were determined by Image J (1.8.0.112, National Institutes of Health).

2.6 Knockdown of target genes with shRNA lentivirus (LV)

LVs with the target gene short hairpin RNA (shRNA) and the corresponding control LVs were provided by Genechem (Shanghai, China). The sequences were as follows: 5'-AAGGAGCAAACACGAGATCTT-3' targeting TET2, 5'-GAGTCAAATCTACAGCATATC-3' targeting MLKL, 5'-ACAGCAACTACATGGTTATAA-3' targeting RIPK3 and 5'-CTTTCTGGCCTCAAGTACT-3' targeting PLK3. HaCaT cells were seeded in 6-well plates at 2.5 × 10⁵ cells per well for the interference experiment. According to the manufacturer's recommendations, they were infected with target genes or control LVs and then cultured at 37°C for 72 hours. Western blotting and qRT-PCR were utilized to confirm silence of these genes prior to the usage of the knockdown cells. Every test was performed 72 hours after transfection.

2.7 RNA isolation and quantitative RT-qPCR

The RNA Fast 200 kit (FASTAGEN) were used following the manufacturer's instructions to was extract total RNA. TransScript All-in-One First-Strand cDNA Synthesis SuperMix for RT-PCR (TransGen Biotech) was used to synthesize complementary DNA. qPCR was carried out using SYBR Green (Vazyme Biotech) on a LightCycler 480 (Roche Diagnostics), and the level of β-actin expression in each sample was used to standardize the data. The relative expression changes were calculated using the 2^−ΔΔCT method.

2.8 Western blot analysis

On 10% SDS-PAGE gels, cell lysates were separated before being applied to nitrocellulose membranes. After being blocked with 5% milk, the membranes were incubated at 4°C for 12 hours with the designated primary antibodies. Membranes were incubated with secondary antibodies at room temperature for two hours after being washed three times with PBST. The protein bands were seen using the ECL western blot substrate. Secondary and primary antibodies in this study are as following: rabbit anti-MLKL (Proteintech, 21066-1-AP), rabbit anti-pho-MLKL (T357/S358) (Abcam, ab187091), rabbit anti-RIPK3 (Abcam, ab209384), rabbit anti-pho-RIPK3(CST, #93654), mouse anti-GAPDH (ABclonal, AC033), horseradish peroxidase (HRP) conjugated donkey anti-rabbit and HRP conjugated donkey anti-mouse were obtained from Proteintech.

2.9 RNA-seq

After transfection with LV-NC or LV-shTET2 lentiviral particles, the HaCaT were treated with 120mJ/cm² dose of UVB. Total cellular RNA was extracted from the different groups using TRIZOL reagent (Beyotime, R0011). To explore the effects of UVB radiation and TET2 knockdown on gene expression in HaCaT cells, RNA-seq analysis was performed at the Sangon Company (Shanghai, China).

2.10 ChIP-seq and ChIP-qPCR

Chromatin immunoprecipitation (ChIP) was performed by Wellbio company (https://wellbiology.com/, Changsha, China). Briefly, to create chromatin fragments between 100 and 750 bp, HaCaT cells were gathered, cross-linked with 1% formaldehyde, and then sonicated by a Bioruptor. The TET2 antibody was then used to immunoprecipitate sonicated materials. By using RT-PCR, the isolated chromatin templates were amplified. The following primers were used to detect the binding of TET2 to the promoter region of RIPK3. Forward primer: CCTCTGGATGGGCTGATAAA, and reverse primer: AGGTGGCTGGGAAAGGTG. And these primers were used to detect the binding of TET2 to the promoter region of MLKL. Forward primer: ATACAGATGGCAAACAAGCA, and reverse primer: AGCGATTCTCCAGCCTCA.

2.11 Cell viability assay

HaCaT cells (5x10⁵/ml) were cultured in 96-well plates and transfected for 48 hours with shRNA in a humidified environment containing 5% CO2. According to the manufacturer's instructions, the CCK-8 kit (Solarbio; CA1210) was used to measure the vitality of the cells. Each well received a dose of CCK-8 solution, and the plates underwent a 14-hour incubation period at 37°C. Using a microplate reader, the absorbance was determined at a wavelength of 450 nm. The assay was carried out 5 times.

2.12 Flow cytometric analysis

HaCaT cells (5x10⁵/ml) were transfected and exposed to UVB radiation before being grown for 48 hours at a temperature of 37°C in a humid environment with 5% CO2. Cells were then extracted, trypsinized (0.25% trypsin at 37°C for 3–5 min), and thrice rinsed with cold PBS. The manufacturer's instructions were followed while using the FITC Annexin V Apoptosis Detection kit (TransDetect Annexin V-FITC/PI Cell Apoptosis Detection Kit; FA101-02) to measure apoptosis. The samples were examined using flow cytometry (BDTM LSR II; BD Biosciences) following a 15-minute incubation period at room temperature. Data analysis was done with the aid of the FlowJo program (v10.8.1; Becton, Dickinson and Company). The sum of the Q2 and Q3 was the cell death rate. The Reactive Oxygen Species Assay Kit (Beyotime; S0033S) was utilized to assess ROS in accordance with the manufacturer's protocol.

2.13 Statistics

All data are presented as mean ± SD. One-way ANOVA test and unpaired t test were used for the comparison between experimental groups. Unpaired t test and one-way ANOVA were employed to compare the experimental groups. Values of P < 0.05 were considered statistically significant.

3.1 TET2 promotes UVB-induced skin photodamage

Our previous study found that TET2 was upregulated in UVB-irradiated HaCaT cells, which provokes us to probe the role of TET2 in UVB-induced skin photodamage. Actinic keratosis (AK), a skin disease characterized by rough scaly patches, is resulted from chronically exposure of ultraviolet (13). Thus, the skin tissues of clinical AK patients were collected and compared with normal skin tissues to explore whether TET2 expression is altered in skin disorders caused by repeated UVB exposure. [This study was approved by IRB of The Third Xiangya Hospital of Central South University (Rapid Ⅰ22143)]. Compared to healthy controls, TET2 expression was significantly upregulated in the tissues of AK patients (Fig. 1a). Meanwhile, in healthy controls, compared to UVB-free skin tissues, TET2 expression in skin tissues exposed to UVB were also higher (Fig. 1b). To further demonstrate TET2 expression level in UVB-irradiated skin, a mouse model of chronic skin photodamage was constructed. The result showed that, after chronically UVB irradiation, the expression of TET2 was higher in UVB-irradiated mice than that of control mice (Fig. 1c). To further characterize the role of TET2 in UVB-induced photodamage in vitro, we diminished the TET2 expression (TET2 KD) in HaCaT cells using shRNA and constructed the stable-TET2-overexpressing (TET2 OE) cell line using plasmid. The knockdown and overexpressing efficiency was validated at both mRNA and protein levels (Supplementary Fig. 1a-f & Supplementary Fig. 2d, e). Flow cytometry was utilized to delineate the effects of TET2 on the intracellular accumulation of ROS and death of UVB-irradiated cells. The results suggested that knockdown of TET2 expression markedly downregulated the ROS production while overexpression of TET2 upregulated it (Fig. 1d, e, f). After deletion of TET2, the cell death caused by UVB exposure reduced 10.63 ± 0.92% compared to control cells (P < 0.0001) (Fig. 1g, h). In addition, after overexpression of TET2 and UVB-irradiation, the death of cells increased 29.62 ± 7.52% compared to control cells (P < 0.0001) (Fig. 1i, j). To further confirm this phenomenon, keratinocyte TET2 deficiency specifically mice, TET2 flox/flox k14-cre mice were applied. Results suggested that the epidermis thickness and the collagen content in TET2 flox/flox k14-cre⁺ mice were markedly less than that of TET2 flox/flox k14-cre⁻ mice(P < 0.0001) under repeated UVB treatment (Fig. 1k, l). Release of IL-6 and MMP-1 were markedly suppressed in TET2 flox/flox k14-cre⁺ mice compared to TET2 flox/flox k14-cre⁻ mice (Fig. 1k, m, n). These results suggested that TET2 may participate in UVB-induced skin photodamage.

3.2 TET2 promotes skin photodamage through upregulating necroptosis

Our previous studies have revealed that during UVB-irradiation, RCD including apoptosis, necroptosis, pyroptosis and ferroptosis are undertaken in keratinocytes (14). Meanwhile, our above flow cytometry results indicated a significant increase in cell mortality after TET2 overexpression in UVB-irradiated cells. To investigate which cell death mode plays a dominant role in TET2-mediated, UVB-induced skin photodamage, cell death inhibitors including pan-caspase inhibitor zVAD-fmk (ZVF, 20uM), necroptosis inhibitor Necrosulfonamide (NSA, 5uM), pyroptosis inhibitor (MCC950, 5uM), and ferroptosis inhibitor Ferrostatin-1 (Fer-1, 1uM) were utilized in TET2 OE cells. 12 hours incubation with these inhibitors and another 24 hours after UVB, NSA, a RIPK3-dependent MLKL inhibitor, was most efficacious in preventing the death of TET2 OE cells after UVB exposure (Fig. 2a, b, c).

As the protective effect of NSA in TET2 OE cells has been described, its sheltering effect in TET2 KD HaCaT cells was further investigated. Our result indicated that cell death rate in HaCaT cells was much higher than that in TET2 KD cells, which further confirmed the promoting effect of TET2 in UVB-induced photodamage. After 12 hours incubation with NSA and another 24 hours after UVB-irradiation, a significant portion of TET2 KD and HaCaT cells has been rescued by NSA (Fig. d, e). These findings suggested that TET2 may promote skin photodamage through upregulating necroptosis.

3.3 TET2 promotes UVB-induced skin photodamage by affecting RIPK3-MLKL mediated necroptosis

Activation of RIPK3, phosphorylation of the downstream MLKL and oligomerization of MLKL to plasma membrane are the essential steps in necroptosis signaling pathway (15). Meanwhile, TET2 upregulates necroptosis signaling pathway has been proved above. Thus, we investigated whether TET2 affect RIPK3-MLKL signaling. Both RIPK3 and MLKL were activated after UVB exposure. After deletion and overexpression of TET2, we detected changes neither in total RIPK3 nor total MLKL but in their phosphorylated forms [phosphorylated RIPK3(pho-RIPK3) and phosphorylated MLKL (pho-MLKL)]. Specifically, TET2 deficiency markedly decreased the expression of pho-RIPK3 and pho-MLKL while TET2 overexpression increased the expression of them (Fig. 3a, b & Supplementary Fig. 2a, b). In parallel, significant changes of RIPK3 and MLKL were not detected at the mRNA level, which suggested that TET2 is not involved in regulating transcription but promotes the activation of them (Supplementary Fig. 1g).

3.4 RIPK3-MLKL mediated necroptosis are involved in UVB-induced skin photodamage

Having established that TET2 regulates RIPK3-MLKL signaling, whether RIPK3-MLKL signaling contribute to UVB-induced skin photodamage remained unanswered. In our animal model of UVB-induced skin photodamage, UVB-irradiation caused marked erythema, thickened skin. Histological examination of the irradiated mice skin presented with significantly thicker epidermal layers and much more collagen content (Fig. 4a). However, subcutaneous pre-treatment of BALB/C mice with RIPK3 kinase inhibitor GSK-872 and MLKL inhibitor NSA significantly improved these indicators with good security (Fig. 4a, b, c).

The histological effect of UVB and these inhibitors were also examined in the skin of the UVB-irradiated BALB/C mice. After UVB exposure or inhibitors pre-treatment, no significant changes in the expression of RIPK3 and MLKL were found (P > 0.05) (Fig. 4d, e, f). Previous studies suggested that UVB exposure induces the transcription and expression of proinflammatory cytokine IL-6 and MMPs (16–18). These markers were also detected in our study. MMP-1 is the major protein for degrading skin collagen (19). It was elevated after UVB irradiation (1.6-fold of normal group) and were diminished by the inhibitors GSK-872 and NSA (Fig. 4d, h). Our result also revealed increased epidermal staining of IL-6 in mice following irradiation compared to the non-irradiated mice skin. Similarly, the release of IL-6 could also be blocked by GSK-872 and NSA (Fig. 4d, g).

We further utilized flow cytometry to examine the ROS accumulation and death of cells after deletion of RIPK3/MLKL signals with shRNA and exposure to UVB, which allowed us to correlate the macroscopical skin lesions with the microcosmic cellular viability of individual cells. The results suggested that ROS accumulation and cell death rate significantly decreased after deletion of RIPK3 and MLKL compared to cells only treated with UVB (Fig. 4i, j, k, l, m, n). Taken together, our results suggested that RIPK3-MLKL signaling are involved and promotes the occurrence of UVB-induced skin photodamage, deletion of these signals could rescue keratinocytes and skin from UVB-induced damage.

3.5 TET2 interacts with RIPK3 and MLKL protein to promoting UVB-induced skin photodamage

TET2, a member of TET family, has been proved to promoting DNA demethylation. As the correlation of TET2 and necroptosis has been described, we investigated whether UVB-induced photodamage could be blocked by Bobcat339, an inhibitor that suppresses TET enzymes function in living cells to reduce abundance of 5-hydroxy methyl cytosine DNA. However, unlike GSK-872 or NSA, no significant changes have been found in the epidermis thickness or dermal collagen content of mice pre-treated with Bobcat339 compared to mice only treated with UVB (Fig. 5b, c). UVB triggered release of IL-6 and MMP-1 in mice skin could not be blocked by Bobcat339 either (Fig. 5d, e). By performing CCK-8 assay, its nonprotective effect on the viability of UVB-irradiated cells was further confirmed (Fig. 5a). Moreover, we analyzed our CHIP-seq data which showed that there was no detectable TET2-binding on the RIPK3 or MLKL promoter (results not shown), but coIP assay showed an interaction between TET2 and RIPK3, as well as an interaction between MLKL (Fig. 5f & Supplementary Fig. 2c). In conclusion, these data suggested that TET2 does not regulate the methylation, transcription and translation of RIPK3-MLKL signals. Instead, RIPK3-MLKL signals are influenced by TET2 and promote the occurrence of UVB induced skin photodamage in a demethylase-independent manner. However, whether intermediate proteins are involved remains unclear.

3.6 TET2 promotes the activation of RIPK3-MLKL signaling by upregulating PLK3 expression

Taken into account that TET2 promoted the phosphorylation of RIPK3 and MLKL but it neither bind to the RIPK3 and MLKL promoter regions nor has phosphorylation function, we speculate maybe key phosphorylation-related enzymes are involved. Thus, we conducted RNA-seq and bioinformatic analysis to seek the key enzymes. After analysis, 148 upregulated genes and 172 downregulated genes triggered by deletion of TET2 and UVB-irradiation were revealed (Fig. 6a). Next, these differentially expressed genes (DEGs) were overlapped with phosphatase and protein kinase database respectively and got 13 phosphatase genes and 62 protein kinase genes. Then, we checked the functions of these obtained genes in Gencards, Uniprot and other databases, and finally got 4 phosphatase genes and 7 protein kinase genes. To determine whether these genes regulated by TET2, these genes were overlapped with TET2-targeted genes database respectively and finally got 3 phosphatase genes and 4 protein kinase genes (Fig. 6b). PPI network between the 7 genes and RIPK3-MLKL signaling was constructed in GeneMANIA to predict whether these genes interact with the RIPK3 and MLKL proteins, and ultimately one phosphatase gene, PLK3, was obtained (Fig. 6c).

RT-qPCR result confirmed that PLK3 expression increased approximately 4.91-folds in UVB-irradiated cells compared to control cells (Fig. 6d). In addition, overexpression of TET2 significantly upregulated cellular PLK3 expression while knockdown of TET2 downregulated it (Fig. 6d, e). In parallel, upregulated PLK3 expression triggered by UVB in mice skin also markedly eliminated by knockdown of TET2 (Fig. 6f, g). Results of coIP assay also showed an interaction between PLK3 and RIPK3, as well as an interaction between MLKL (Fig. 6h, i, j & Supplementary Fig. 2f, g, h).

CCK-8 assay and flow cytometry was utilized to further delineate the effects of PLK3. Deleting PLK3 with shRNA (PLK3 KD) significantly protected the viability of UVB-irradiated cells (Fig. 7a). Meanwhile, compared to UVB-free cells, knockdown of PLK3 markedly downregulated the ROS accumulation and death of UVB-irradiated cells. Specifically, the accumulation of ROS in UVB-irradiated cells was 1.91-folds compared to UVB-irradiated PLK3 KD cells (Fig. 7b, c). Cell death rate was 18.81 ± 0.51 in UVB-irradiated PLK3 KD cells while 28.88 ± 1.67 in only UVB irradiated cells (Fig. 7d, e).

Taken together, these results indicated that TET2 promotes the activation of RIPK3-MLKL signal by upregulating PLK3, as a result, contribute to the occurrence of skin photodamage.

Contradictorily, UVR can either worsen or improve skin disorders. It involves in the onset and advancement of numerous skin disorders including lupus erythematosus, psoriasis and even skin cancer. However, it has also been used to treat a number of skin problems (20–22). Previous studies have reported that acute or chronic exposure to UVB arises ROS accumulation, DNA damage, and skin inflammation. Focusing on this, diverse signaling pathways and molecules in the process of UVB-induced skin photodamage have been reported. Recently, numerous studies have revealed that TET2 plays a crucial role in various inflammatory related diseases including atherosclerosis, type I diabetes, rheumatoid arthritis, and lupus-like diseases (6). Our previous study also showed altered expression of TET2 in HaCaT after UVB exposure. However, the specific role of TET2 in skin inflammation caused by UVB exposure are not fully understood. Herein, we showed that TET2 significantly upregulated in UVB-irradiated HaCaT cells and skin. TET2 deficiency protect HaCaT and mice from UVB-induced photodamage.

TET2, a DNA demethylation enzyme, influences cell cycle progression and proliferation in different cell lines (23, 24). Besides, recent studies have also revealed its role in demethylating 5mC in mRNA (25). The regulatory role of TET2 independent of its methylase has been demonstrated in recent studies. According to Zhang et al., TET2 recruited Hdac2 and inhibited IL-6 transcription by histone deacetylation during the resolution of inflammation in innate myeloid cells, independent of its DNA methylation and hydroxymethylation (26). Additionally, Montagner et al. discovered that TET2’s carboxy-terminal catalytic region could restore the proliferation of TET2-deleted mast cells without affecting its catalytic activity (27). Accumulating evidence suggest that TET2 take part in the genesis and progression in many diseases including diabetes, psoriasis and hemopathy (28–30). Furthermore, the role of TET2 in regulating skin inflammatory and skin disorders has also been found. Recent studies showed that knockdown of TET2 greatly improved HaCaT cell viability, lessened the psoriasiform phenotype and reduced the level of proinflammatory cytokines in mice (28, 31). In this work, we noticed that deletion of TET2 effectively prevented photodamage caused by UVB in vitro and vivo. Specifically, after UVB radiation, overexpressed TET2 promoted the intracellular ROS accumulation and death of keratinocytes, as well as increased the release of MMP-1 and initiated skin inflammation. However, the mechanism by which TET2 caused these changes and mediated skin inflammation need to be further explored.

Our earlier research indicated that various types of RCD are produced by keratinocytes in response to UVB when they are unable to repair and neutralize the damage. RCD functioned in a variety of processes, including embryonic development, organ maintenance, aging, and the harmony of immune responses and autoimmune diseases (32). Our earlier study also showed that necroptosis, a type of RCD, contributed to various infection-related, immune-mediated skin diseases, or even malignant skin tumors (33). Nevertheless, the majority of studies revealed that the typical processes for cell death in response to UVB are apoptosis and ferroptosis (34, 35). To explore which type of RCD plays predominant role in photodamage mediated by overexpressed TET2, we utilized several RCD inhibitors in our work. Herein, TET2 overexpression mediated photodamage could be largely reversed by necroptosis inhibitor, NSA. This protective effect not only in maintaining cell viability, reducing intracellular ROS accumulation and death in TET2 OE cells, but also in preventing the formation of skin lesions, decreasing the release of inflammatory cytokines in UVB-irradiated mice, which provides compelling evidence that necroptosis is the dominate RCD occurred in TET2 mediated photodamage. Necroptosis, a type of programmed necrosis primarily made up of RIPK3-MLKL, is triggered by death domain receptors like TNFR and Toll-like receptor-3/4 (TLR3/4). After RIPK3 phosphorylated, its downstream MLKL were activated to form the necrosome. MLKL oligomers then move to the plasma membrane and create pores that leads to necroptotic cell death through allowing ion influx, cell swelling, and membrane lysis (15, 36–38). It has been discovered as an important regulator in tumor genesis and progression, neurodegenerative diseases like Alzheimer disease, acute kidney injury, pulmonary diseases, autoimmune diseases including rheumatoid arthritis, infectious disease particularly viral infections (15, 39–43). ROS-mediated necroptosis also been proved to taking part in the development of skin diseases including psoriasis and vitiligo (44, 45). Recently, studies provided further evidence that necroptosis is a strong trigger of skin inflammation and contribute to the severe cutaneous adverse drug reaction, Stevens–Johnson syndrome (46–48). In this work, deletion of both RIPK3 and MLKL rescues HaCaT from UVB-triggered damage, it provides compelling evidence that RIPK3-MLKL-dependent necroptosis promote the induction of UVB-induced photodamage. In addition, knockdown of TET2 markedly decreased the activation of RIPK3 and MLKL while overexpressing of TET2 upregulated the activation of them. Moreover, on a protein level, interactions between TET2 and RIPK3-MLKL were also verified. Thus, our study revealed the underlying relationship between TET2 mediated, UVB-induced skin injury and RIPK3-MLKL signaling.

However, to our knowledge, TET2 does not possess a protein kinase function, nor does it participate in the methylation of RIPK3/MLKL. Moreover, in our results, the demethylase function of TET2 did not present any protective effect against UVB-induced skin photodamage in mice. It is possible that there is a protein kinase crosstalk between TET2 and RIPK3-MLKL signaling. Multiple evidence suggests that RIPK1 kinase activity is indispensable for IFN-α-induced RIPK3 activation and necroptosis, other studies also revealed the role of TRIF, ZBP1, and ICP6 protein in activating RIPK3-MLKL signaling (49, 50). In our study, utilizing RNA-seq and bioinformatics analysis, we found another protein kinase PLK3, which may activate RIPK3-MLKL signaling as well as targeted by TET2. PLK3, an evolutionarily conserved Ser/Thr protein kinase in the mammalian PLK family, plays an important role in the cell cycle and mitosis. It responses to various environmental stresses (51). Studies have proved it to be a tumor suppressor since it blocks the cell proliferation and initiates apoptosis (52, 53). Studies have also revealed that PLK3 is a stress response protein linked to DNA damage and that miR-24 directly targets it to restrict the intrinsic growth potential of hair follicle progenitors (54, 55). To our knowledge, the relationship between PLK3 and skin inflammation or skin disorders is rarely reported. In this work, UVB radiation upregulated the expression of PLK3 in HaCaT, deletion of PLK3 rescued a significant portion of UVB-irradiated cells from death. This finding uncovered a unique function of PLK3 in promoting photodamage in keratinocytes. Moreover, knockout of TET2 downregulated PLK3 expression in mouse skin. Protein interactions between PLK3, TET2 and RIPK3/MLKL were also confirmed. These data demonstrated that PLK3 indeed involved in the TET2 mediated, UVB-induced photodamage. However, the binding sites of PLK3 on RIPK3/MLKL and its function in promoting skin photodamage in vivo still need to be further explored.

In conclusion, our study uncovered the role of TET2 in regulation of the necroptosis in the skin photodamage, and discovered the key protein kinase, PLK3, in connecting TET2 and necroptosis. This work provides potential therapeutic target to treat UVB-induced skin photodamage.

Conflict of Interest

The authors declare no competing interests.

Availability of Data and Materials

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgements

DW is supported in part by:

1. The Wisdom Accumulation and Talent Cultivation Project of the Third xiangya hospital of Central South University (YX202201);

2. Outstanding Youth Project of Hunan Provincial Natural Science Foundation (2022JJ20093);

3.Youth Project of National Natural Science Foundation of China (82202391)

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Narayanan DL, Saladi RN, Fox JL. Ultraviolet radiation and skin cancer. Int J Dermatol. 2010;49(9):978–86.
Zou W, González A, Jampaiah D, Ramanathan R, Taha M, Walia S, et al. Skin color-specific and spectrally-selective naked-eye dosimetry of UVA, B and C radiations. Nat Commun. 2018;9(1):3743.
Kawashima S, Funakoshi T, Sato Y, Saito N, Ohsawa H, Kurita K, et al. Protective effect of pre- and post-vitamin C treatments on UVB-irradiation-induced skin damage. Sci Rep. 2018;8(1):16199.
Wang M, Charareh P, Lei X, Zhong JL. Autophagy: Multiple Mechanisms to Protect Skin from Ultraviolet Radiation-Driven Photoaging. Oxid Med Cell Longev. 2019;2019:8135985.
Passeron T, Lim HW, Goh CL, Kang HY, Ly F, Morita A, et al. Photoprotection according to skin phototype and dermatoses: practical recommendations from an expert panel. J Eur Acad Dermatol Venereol. 2021;35(7):1460–9.
Cong B, Zhang Q, Cao X. The function and regulation of TET2 in innate immunity and inflammation. Protein Cell. 2021;12(3):165–73.
Chen GD, Fatima I, Xu Q, Rozhkova E, Fessing MY, Mardaryev AN, et al. DNA dioxygenases Tet2/3 regulate gene promoter accessibility and chromatin topology in lineage-specific loci to control epithelial differentiation. Sci Adv. 2023;9(2):eabo7605.
Li L, Li F, Xia Y, Yang X, Lv Q, Fang F, et al. UVB induces cutaneous squamous cell carcinoma progression by de novo ID4 methylation via methylation regulating enzymes. EBioMedicine. 2020;57:102835.
López-Nevado M, González-Granado LI, Ruiz-García R, Pleguezuelo D, Cabrera-Marante O, Salmón N, et al. Primary Immune Regulatory Disorders With an Autoimmune Lymphoproliferative Syndrome-Like Phenotype: Immunologic Evaluation, Early Diagnosis and Management. Front Immunol. 2021;12:671755.
Wu H, Deng Y, Long D, Yang M, Li Q, Feng Y, et al. The IL-21-TET2-AIM2-c-MAF pathway drives the T follicular helper cell response in lupus-like disease. Clin Transl Med. 2022;12(3):e781.
Bonvin E, Radaelli E, Bizet M, Luciani F, Calonne E, Putmans P, et al. TET2-Dependent Hydroxymethylome Plasticity Reduces Melanoma Initiation and Progression. Cancer Res. 2019;79(3):482–94.
Li F, Yuan CW, Xu S, Zu T, Woappi Y, Lee CAA, et al. Loss of the Epigenetic Mark 5-hmC in Psoriasis: Implications for Epidermal Stem Cell Dysregulation. J Invest Dermatol. 2020;140(6):1266-75.e3.
Gutzmer R, Wiegand S, Kölbl O, Wermker K, Heppt M, Berking C. Actinic Keratosis and Cutaneous Squamous Cell Carcinoma. Dtsch Arztebl Int. 2019;116(37):616–26.
Tang Z, Tong X, Huang J, Liu L, Wang D, Yang S. Research progress of keratinocyte-programmed cell death in UV-induced Skin photodamage. Photodermatol Photoimmunol Photomed. 2021;37(5):442–8.
Yan J, Wan P, Choksi S, Liu ZG. Necroptosis and tumor progression. Trends Cancer. 2022;8(1):21–7.
Kammeyer A, Luiten RM. Oxidation events and skin aging. Ageing Res Rev. 2015;21:16–29.
Kennedy Crispin M, Fuentes-Duculan J, Gulati N, Johnson-Huang LM, Lentini T, Sullivan-Whalen M, et al. Gene profiling of narrowband UVB-induced skin injury defines cellular and molecular innate immune responses. J Invest Dermatol. 2013;133(3):692–701.
Yang CY, Guo Y, Wu WJ, Man MQ, Tu Y, He L. UVB-Induced Secretion of IL-1β Promotes Melanogenesis by Upregulating TYR/TRP-1 Expression In Vitro. Biomed Res Int. 2022;2022:8230646.
Pittayapruek P, Meephansan J, Prapapan O, Komine M, Ohtsuki M. Role of Matrix Metalloproteinases in Photoaging and Photocarcinogenesis. Int J Mol Sci. 2016;17(6).
Bald T, Quast T, Landsberg J, Rogava M, Glodde N, Lopez-Ramos D, et al. Ultraviolet-radiation-induced inflammation promotes angiotropism and metastasis in melanoma. Nature. 2014;507(7490):109–13.
Kuhn A, Wenzel J, Weyd H. Photosensitivity, apoptosis, and cytokines in the pathogenesis of lupus erythematosus: a critical review. Clin Rev Allergy Immunol. 2014;47(2):148–62.
Wolf P, Weger W, Patra V, Gruber-Wackernagel A, Byrne SN. Desired response to phototherapy vs photoaggravation in psoriasis: what makes the difference? Exp Dermatol. 2016;25(12):937–44.
Ichiyama K, Chen T, Wang X, Yan X, Kim BS, Tanaka S, et al. The methylcytosine dioxygenase Tet2 promotes DNA demethylation and activation of cytokine gene expression in T cells. Immunity. 2015;42(4):613–26.
Chrysanthou S, Senner CE, Woods L, Fineberg E, Okkenhaug H, Burge S, et al. A Critical Role of TET1/2 Proteins in Cell-Cycle Progression of Trophoblast Stem Cells. Stem Cell Reports. 2018;10(4):1355–68.
Fu L, Guerrero CR, Zhong N, Amato NJ, Liu Y, Liu S, et al. Tet-mediated formation of 5-hydroxymethylcytosine in RNA. J Am Chem Soc. 2014;136(33):11582–5.
Zhang Q, Zhao K, Shen Q, Han Y, Gu Y, Li X, et al. Tet2 is required to resolve inflammation by recruiting Hdac2 to specifically repress IL-6. Nature. 2015;525(7569):389–93.
Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, et al. TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Cell Rep. 2016;15(7):1566–79.
Wang X, Liu X, Duan X, Zhu K, Zhang S, Gan L, et al. Ten-eleven Translocation-2 Regulates DNA Hydroxymethylation Status and Psoriasiform Dermatitis Progression in Mice. Acta Derm Venereol. 2018;98(6):585–93.
Fuster JJ, Zuriaga MA, Zorita V, MacLauchlan S, Polackal MN, Viana-Huete V, et al. TET2-Loss-of-Function-Driven Clonal Hematopoiesis Exacerbates Experimental Insulin Resistance in Aging and Obesity. Cell Rep. 2020;33(4):108326.
Bensberg M, Rundquist O, Selimović A, Lagerwall C, Benson M, Gustafsson M, et al. TET2 as a tumor suppressor and therapeutic target in T-cell acute lymphoblastic leukemia. Proc Natl Acad Sci U S A. 2021;118(34).
Liu X, Wang X, Liu N, Zhu K, Zhang S, Duan X, et al. TET2 is involved in DNA hydroxymethylation, cell proliferation and inflammatory response in keratinocytes. Mol Med Rep. 2020;21(4):1941–9.
Bertheloot D, Latz E, Franklin BS. Necroptosis, pyroptosis and apoptosis: an intricate game of cell death. Cell Mol Immunol. 2021;18(5):1106–21.
Liu L, Tang Z, Zeng Y, Liu Y, Zhou L, Yang S, et al. Role of necroptosis in infection-related, immune-mediated, and autoimmune skin diseases. J Dermatol. 2021;48(8):1129–38.
Sollberger G, Strittmatter GE, Grossi S, Garstkiewicz M, Auf dem Keller U, French LE, et al. Caspase-1 activity is required for UVB-induced apoptosis of human keratinocytes. J Invest Dermatol. 2015;135(5):1395–404.
Vats K, Kruglov O, Mizes A, Samovich SN, Amoscato AA, Tyurin VA, et al. Keratinocyte death by ferroptosis initiates skin inflammation after UVB exposure. Redox Biol. 2021;47:102143.
Sun L, Wang H, Wang Z, He S, Chen S, Liao D, et al. Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell. 2012;148(1–2):213–27.
Cai Z, Jitkaew S, Zhao J, Chiang HC, Choksi S, Liu J, et al. Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis. Nat Cell Biol. 2014;16(1):55–65.
Chen X, Li W, Ren J, Huang D, He WT, Song Y, et al. Translocation of mixed lineage kinase domain-like protein to plasma membrane leads to necrotic cell death. Cell Res. 2014;24(1):105–21.
Dionísio PA, Amaral JD, Rodrigues CMP. Molecular mechanisms of necroptosis and relevance for neurodegenerative diseases. Int Rev Cell Mol Biol. 2020;353:31–82.
Martin-Sanchez D, Fontecha-Barriuso M, Carrasco S, Sanchez-Niño MD, Mässenhausen AV, Linkermann A, et al. TWEAK and RIPK1 mediate a second wave of cell death during AKI. Proc Natl Acad Sci U S A. 2018;115(16):4182–7.
Mizumura K, Maruoka S, Gon Y, Choi AM, Hashimoto S. The role of necroptosis in pulmonary diseases. Respir Investig. 2016;54(6):407–12.
Weisel K, Scott NE, Tompson DJ, Votta BJ, Madhavan S, Povey K, et al. Randomized clinical study of safety, pharmacokinetics, and pharmacodynamics of RIPK1 inhibitor GSK2982772 in healthy volunteers. Pharmacol Res Perspect. 2017;5(6).
Khoury MK, Gupta K, Franco SR, Liu B. Necroptosis in the Pathophysiology of Disease. Am J Pathol. 2020;190(2):272–85.
Jiang BW, Zhang WJ, Wang Y, Tan LP, Bao YL, Song ZB, et al. Convallatoxin induces HaCaT cell necroptosis and ameliorates skin lesions in psoriasis-like mouse models. Biomed Pharmacother. 2020;121:109615.
Chen J, Li S, Li C. Mechanisms of melanocyte death in vitiligo. Med Res Rev. 2021;41(2):1138–66.
Schünke H, Göbel U, Dikic I, Pasparakis M. OTULIN inhibits RIPK1-mediated keratinocyte necroptosis to prevent skin inflammation in mice. Nat Commun. 2021;12(1):5912.
Kinoshita M, Ogawa Y, Hama N, Ujiie I, Hasegawa A, Nakajima S, et al. Neutrophils initiate and exacerbate Stevens-Johnson syndrome and toxic epidermal necrolysis. Sci Transl Med. 2021;13(600).
Shlomovitz I, Erlich Z, Speir M, Zargarian S, Baram N, Engler M, et al. Necroptosis directly induces the release of full-length biologically active IL-33 in vitro and in an inflammatory disease model. Febs j. 2019;286(3):507–22.
Liu S, Joshi K, Denning MF, Zhang J. RIPK3 signaling and its role in the pathogenesis of cancers. Cell Mol Life Sci. 2021;78(23):7199–217.
Jiao H, Wachsmuth L, Kumari S, Schwarzer R, Lin J, Eren RO, et al. Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation. Nature. 2020;580(7803):391–5.
Zitouni S, Nabais C, Jana SC, Guerrero A, Bettencourt-Dias M. Polo-like kinases: structural variations lead to multiple functions. Nat Rev Mol Cell Biol. 2014;15(7):433–52.
Conn CW, Hennigan RF, Dai W, Sanchez Y, Stambrook PJ. Incomplete cytokinesis and induction of apoptosis by overexpression of the mammalian polo-like kinase, Plk3. Cancer Res. 2000;60(24):6826–31.
Deng W, Wei X, Xie Z, Zhang R, Dong Z, Zhang J, et al. Inhibition of PLK3 Attenuates Tubular Epithelial Cell Apoptosis after Renal Ischemia-Reperfusion Injury by Blocking the ATM/P53-Mediated DNA Damage Response. Oxid Med Cell Longev. 2022;2022:4201287.
Bahassi el M, Conn CW, Myer DL, Hennigan RF, McGowan CH, Sanchez Y, et al. Mammalian Polo-like kinase 3 (Plk3) is a multifunctional protein involved in stress response pathways. Oncogene. 2002;21(43):6633–40.
Liu F, Zhang X, Peng Y, Zhang L, Yu Y, Hua P, et al. miR-24 controls the regenerative competence of hair follicle progenitors by targeting Plk3. Cell Rep. 2021;35(10):109225.

(Not answered)

Download PDF

Version 1

posted

You are reading this latest preprint version

TET2 amplifies RIPK3/MLKL necroptosis signal by upregulation of PLK3 to promote UVB-induced skin photodamage

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 antibodies and reagents

2.2 Cell culture

2.3 Ultraviolet B irradiation

2.4 Animal models of skin photodamage and treatment with inhibitors

2.5 Histopathological Evaluation and Immunohistochemistry

2.6 Knockdown of target genes with shRNA lentivirus (LV)

2.7 RNA isolation and quantitative RT-qPCR

2.8 Western blot analysis

2.9 RNA-seq

2.10 ChIP-seq and ChIP-qPCR

3. Result

3.1 TET2 promotes UVB-induced skin photodamage

3.2 TET2 promotes skin photodamage through upregulating necroptosis

3.3 TET2 promotes UVB-induced skin photodamage by affecting RIPK3-MLKL mediated necroptosis

3.4 RIPK3-MLKL mediated necroptosis are involved in UVB-induced skin photodamage

3.5 TET2 interacts with RIPK3 and MLKL protein to promoting UVB-induced skin photodamage

3.6 TET2 promotes the activation of RIPK3-MLKL signaling by upregulating PLK3 expression

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1