Oocyte maturation
Porcine ovaries were collected from a local slaughterhouse. Follicular fluid was aspirated from antral follicles at 3–6 mm in diameter. Cumulus-oocyte complexes (COCs) were selected under a stereomicroscope. Subsequently, COCs were cultured in a 4-well plate containing 400 µL in vitro maturation medium (TCM-199 supplemented with 5% FBS, 10% porcine follicular fluid, 10 IU/mL eCG, 5 IU/mL hCG, 100 ng/mL L-Cysteine, 10 ng/mL EGF, 0.23 ng/mL melatonin, 2.03 × 10− 5 ng/mL LIF, 2 × 10− 5 ng/mL IGF-1, 4 × 10− 5 ng/mL FGF2, 100 U/mL penicillin and 100 mg/mL streptomycin) for 44 h at 38.5 ºC, 5% CO2 and saturated humidity. Cumulus cells surrounding oocytes was removed using 1 mg/mL hyaluronidase following maturation.
Parthenogenetic activation (PA)
MII (metaphase II) oocytes were stimulated using two pulses of direct current (1.56 kV/cm for 80 ms) in activation medium (0.3 M mannitol supplemented with 0.1 mM CaCl2, 0.1 mM MgCl2 and 0.01% polyvinyl alcohol). Subsequently, activated oocytes were washed with porcine zygote medium (PZM-3) three times and were incubated in the chemically assisted activation medium (PZM-3 supplemented with 10 µg/mL cycloheximide and 10 µg/mL cytochalasin B) for 4 h. Then, embryos were cultured in PZM-3 droplets at 38.5 °C, 5% CO2 and 95% air with saturated humidity.
In vitro fertilization (IVF)
MII oocytes were washed in the modified Tris-buffered medium (mTBM) containing 2 mg/mL BSA and 2 mM caffeine. Approximately 15 oocytes were incubated in 50 µL droplets of mTBM for 4 h at 38.5 °C in 5% CO2 in air. Semen from two boars was mixed and centrifuged at 1900 g for 4 min in DPBS supplemented with 1 mg/mL BSA (pH 7.3). Then, sperm was resuspended with mTBM to a concentration of 1 × 106 cells/mL. Fifty microliters of sperm solution were added to the mTBM droplets containing oocytes. After co-incubation of oocytes and sperm for 6 h, excess sperm surrounding oocytes were washed out and presumptive zygotes were cultured in PZM-3 at 38.5 C in 5% CO2 in air.
In vitro transcription
METTL3-EGFP mRNA used for microinjection was synthesized in vitro. pIVT- METTL3-EGFP plasmid containing T7 promoter was linearized by digestion with BspQI. Linearized DNA templates were purified using a DNA clean & concentrator Kit (ZYMO RESEARCH, D4003, Tustin, CA, USA). According to the manufacture’s manual, in vitro transcription of METTL3-EGFP mRNA was performed through using mMESSAGE MACHINE TM T7 kit (Ambion, AM1344, shanghai, China) and Poly (A) Tailing Kit (Ambion, AM1350, Shanghai, China). Then, mRNA was treated with TURBO Dnase to remove the DNA templates and was further purified using MEGAclear Kit (Ambion, AM1908, Shanghai, China). After dissolving mRNA in RNase-free water, mRNA concentration was determined by a Nanodrop instrument (Thermo Scientific, Shanghai, China) and was then aliquoted and stored at -80 °C.
Microinjection
siRNA species were designed to target three different sites of the porcine METTL3 coding region (GenePharma, Shanghai, China). Information on the siRNA sequences used in this study was listed in Table 1. Microinjection was performed in a T2 (TCM199 with 2% FBS) medium containing 7.5 µg/ml Cytochalasin B on an inverted microscope (Olympus, Japan). Approximately 10 pl of siRNA solution (50 µM) was microinjected into the cytoplasm of MII oocytes. Embryos were cultured in PZM-3 medium for 7 days.
Table 1
Information on METTL3 siRNA sequences
No. siRNA | Sequence (5'-3') |
Sense | Antisense |
1 | GCACUCGAAAGAUUGAAUUTT | AAUUCAAUCUUUCGAGUGCTT |
2 | GCAUUGGAUCUUCGGAAUTT | AUUCCGAAGAUCCAAGUGCTT |
3 | GCAAGAAUUCUGUGACUAUTT | AUAGUCACAGAAUUCUUGCTT |
Real-time quantitative PCR (qPCR)
Total RNA was extracted from oocytes and embryos using RNeasy Mini Kit (Qiagen, 74104). RNA was transcriptionally reversed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, 205311). cDNA was aliquoted and was stored at -80 ºC. The primers used in this study were listed in Table 2. The assembly of polymerase chain reaction was prepared in FastStart SYBR Green Master (Roche, 04673514001) and was run on StepOne Plus (Applied Biosystems, Foster, USA). The samples were collected three times and three biological replicates were conducted for each gene. EF1A1 was used as the internal reference gene. The Cq values were obtained and analyzed using the 2−ΔΔCt method.
Table 2
Porcine-specific primer sequences used in this study
Gene symbol | Primer sequences (5'-3') | Product size (bp) | GenBank accession number |
METTL3 | F: CTGGGGTTACGAACGGGTAG | 125 | XM_003128580.5 |
R: TGACACCAACCAAGCAGTGT |
METTL14 | F: GGGAGAGTGTGTTTACGCAAGTG | 145 | XM_003129231.6 |
R: TTCCCATAAGGCAGTGTTCCTT |
WTAP | F: CTGCACGCAGGGAAAACAT | 140 | XM_005659114.3 |
R: TGGGTCGACCATTGTTGATCT |
ATG5 | F: GGTTTGAATATGAAGGCACACCA | 100 | NM_001037152.2 |
R: TGTGATGTTCCAAGGAAGAGCTG |
BECLIN1 | F: AGGAGCTGCCGTTGTACTGTTCT | 105 | NM_001044530.1 |
R: TGCTGCACACAGTCCAGGAA |
LC3 | F: AACGAAATTCCTGGTGCCTGA | 101 | NM_001170827.1 |
R: AAGGCTTGGTTAGCATTGAGCTG |
BCL2 | F: GGTACCGGAGGGCATTCAGT | 100 | NM_214285 |
R: TCCCGGAAGAGTTCGTTCAC |
BAX | F: TGCTTCAGGGTTTCATCC | 112 | XM_003127290.4 |
R: AGACACTCGCTCAACTTC |
CASPASE3 | F: GGATTGAGACGGACAGTG | 109 | NM_214131.1 |
R: CGCCAGGAATAGTAACCAG |
P53 | F: CCACCATCCACTACAACTTC | 135 | NM_213824.3 |
R: AAACACGCACCTCAAAGC |
SOX2 | F: CGCAGACCTACATGAACG | 103 | NM_001123197.1 |
R: TCGGACTTGACCACTGAG |
CDX2 | F: AGTCGCTACATCACCATTCGGAG | 139 | NM_001278769.1 |
R: GCTGCTGTTGCTGCAACTTCTTC |
EF1α1 | F: ATTGTTGCTGCTGGTGTTG | 161 | NM_001097418-2 |
R: TCATATCTCTTCTGGCTGTAGG |
F: forward, R: reverse | | | |
Single-cell qPCR
Primer pool containing multiple genes was prepared according to the instructions of the Single Cell Sequence Specific Amplification Kit (Vazyme, P621-01, Nanjing, China). Individual blastomeres or embryos were transferred into Master Mix and immediately transcriptionally reversed into cDNA at -80 ºC for 2 min. Then, the amplification of cDNA was performed according to the manufacture’s manual. The relative levels of the target genes were detected on a StepOne Plus real-time PCR system (Applied Biossystems) using a pre-amplified cDNA as a template using SYBR Green PCR Master Mix (Applied Biossystems).
Identification of TE and ICM blastomeres of blastocysts
Zona pellucida of blastocysts was removed by digestion of 3.3 mg/mL pronase for 3 min. Zona-free blastocysts were incubated in 0.25% trypsin for 40 min. Individual blastomeres were isolated by repeated pipetting of blastocysts with glass needle at 100 µm in diameter. Individual blastomeres were lysed using single cell quantitative kit. Samples were pre-amplified for 20 cycles according to the manufacture’s protocol. The relative levels of SOX2 and CDX2 mRNA were detected by single-cell qPCR. Then, data were further analyzed by principal component analysis (PCA) using SIMCA14.1 software [29]. Blastomeres from TE and ICM were identified according to the clustering analyses.
mRNA stability
Embryos at the morula stage were treated with 25 µg/mL α-amanitin (MCE, HY-19160) to inhibit global mRNA transcription. Embryos were collected at 0, 12, 24, 36, 48, and 60 h and total RNA was extracted for reverse transcription. The levels of ATG5 mRNA were determined using single-cell qPCR.
Immunofluorescence staining
Oocytes and embryos were fixed in 4% paraformaldehyde solution for 15 min, permeabilized with 1% Triton X-100 for 30 min at room temperature (RT) and then blocked with 2% BSA at RT for 1 h. Samples were incubated in solution containing primary antibodies overnight at 4 °C. After washing, samples were incubated for 1 h in solution containing secondary antibodies in the dark at 37 °C. Afterwards, samples were counterstained using 4, 6-diamidino-2-phenylindole dihydrochloride or propidium iodide for 10 min and were then loaded onto glass slides. Finally, samples were imaged using laser scanning confocal microscopy (Olympus, Japan). The average pixel intensity of embryos was determined using Image J. Information regarding primary and secondary antibodies used was listed in Table 3.
Table 3
Information on antibodies used in the present study
Primary Antibody | Species | Vendor | Cat.no.and dilution |
m6A | Rabbit | abcam | ab190866 (1:75) |
CDX2 | Mouse | Biogenex | AM392 (ready to use) |
ATG5 | Rabbit | Bioss | bs-4005R(1:200) |
LC3B | Rabbit | Cell Signaling | 2775S (1:200) |
Secondary Antibody | Species | Vendor | Cat.no.and dilution |
Alexa Fluor 488 anti-mouse IgG | Goat | Invitrogen | A11029 (1:200) |
Alexa Fluor 594 anti-mouse IgG | Goat | Invitrogen | A11005 (1:200) |
Alexa Fluor 488 anti-rabbit IgG | Goat | Invitrogen | A11008 (1:200) |
Alexa Fluor 594 anti-rabbit IgG | Goat | Invitrogen | A11012 (1:200) |
Treatment of embryos with 3MA
The 3-methyladenine autophagy inhibitor, 3MA (MCE, HY-19312) was dissolved in PZM-3 and stored at -20 °C until it was used. Working solution of 0.1 mM 3MA was prepared in PZM-3. To evaluate the effects of 3MA on autophagy and blastocyst development, morula was cultured in the presence and absence of 3MA for 72 h.
TdT (terminal deoxynucleotidyl transferase)-mediated dUDP nick-end (TUNEL) staining
Blastocysts were fixed in 4% PFA for 15 min at RT. Following several washing, blastocysts were incubated in DNase I (TIANGEN, RT411, China) for 1 h at 38.5 °C. After washing, blastocysts with the treatment of label solution (In Situ Cell Death Detection Kit, 7791-13-1, Roche, Germany) served as the negative control group. Blastocysts with the treatment of enzyme solution served as the positive control group. Blastocysts without the treatment of DNase I from other groups were directly incubated in enzyme solution for 1 h. All blastocysts were stained with DAPI for 15 min and were then imaged using laser scanning confocal microscopy (Olympus, Japan). Total number of cells and number of apoptotic dead cells were counted and apoptotic ratio were calculated by dividing the number of dead cells by the total number of cells, which included dead cells.
Statistical analysis
All experiments were carried out at least three times. Data were analyzed using one-way ANOVA or student’s t test (SPSS 17.0) and were presented as mean ± standard error of mean (mean ± S.E.M). P < 0.05 was considered to be statistically significant.