Brazilin inhibits the inflammatory immune response induced by LPS in THP-1 cells

doi:10.21203/rs.3.rs-2727104/v1

Download PDF

Research Article

Brazilin inhibits the inflammatory immune response induced by LPS in THP-1 cells

https://doi.org/10.21203/rs.3.rs-2727104/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective

To investigate the inhibitory effect of Brazilin (BN) on the inflammatory response of THP-1-derived macrophages induced by LPS.

Methods

THP-1 cells were induced with PMA to extend pseudopodia and form macrophages, and the inflammatory model was induced by LPS. The cell survival rate intervented by Brazilin was determined by the CCK-8 method, and the expression of PD-1 was detected by Flow cytometry, and contents of the cytokines IL-10 and TNF-α in the extracted supernatant of THP-1 cells were detected by ELISA, and the mRNA level was detected by RT‒PCR, while the protein level were detected by Western blot.

Results

The results showed that the best concentration of Brazilin was 12 µg/mL. The best concentration of simvastatin was 15 µg/mL, and the growth was concentration dependent. The expression of PD-1 on the cell surface in the two groups was significantly decreased compared with the control group, and the differences in the Brazilin group and the simvastatin group were significant (P < 0.01; P < 0.001; P < 0.001). The concentrations of TNF-α in the drug groups were significantly decreased while the IL-10 concentration was increased, and compared with the model group, the two drug groups were highly statistically significant (P < 0.001). The mRNA and the protein expression levels of PD-1, NF-κB, TLR4 and MMP-9 in the test groups had extremely significant difference compared with the model group (P < 0.001).

Conclusion

Brazilin

Inflammatory immune response

THP-1

LPS

Atherosclerosis

The inflammatory response is a defence against internal and external stimuli and can promote the repair of damage, but excessive inflammation will lead to prolonged inflammation. LPS (lipopolysaccharide) is expressed and released, causing an inflammatory response.

An intricate physiological process, the inflammatory response involves the immune system being activated. In addition to assisting to speed up damage repair, inflammation is crucial for locating and eliminating invasive infections. However, if severe inflammation persists unchecked for an extended period of time, the immune system may get activated and proceed to disrupt host tissues, leading to chronic disease states. Numerous chronic pathological disorders, including cancer, atherosclerosis, and cardiovascular illnesses, are linked to inflammation.

It has been proposed that vascular inflammatory processes are crucial for the beginning and development of atherosclerosis^[1]. Inflammatory cells invade the vasculature as a result, ingest oxidized lipids, and develop into foam cells that form the plaque's core and are encased in a fibrous cap that keeps the plaque stable. Inflammatory cells in the plaque release substances that attract more immune cells and prevent their clearance, leading to a prolonged inflammatory state and plaque development. Larger plaques that chronically obstruct blood flow (> 70% stenosis) produce symptoms like angina or claudication. However, matrix metalloproteinases, which are also released by plaque inflammatory cells, have the ability to break down the fibrous cap and ultimately cause plaque rupture, thrombosis, and acute ischaemia, which is the primary cause of the majority of MIs and strokes. Recent studies of anti-inflammatory therapies for the prevention of cardiovascular events have been prompted by the essential role that inflammation plays in atherosclerosis^{[2, 3]}.

Caesalpinia sappan L. is a synonym of Biancaea sappan (L.) Tod, which is the dry heartwood of the leguminous plant sappanwood. It is cultivated in Yunnan, Guizhou, Sichuan, Guangxi, Guangdong, Fujian and Taiwan Province. Among them, Guangxi is the main production and cultivation area. Wild distribution occurs in Jinsha River valley (Yuanmou, Qiaojia) and Honghe River Valley in Yunnan Province. Native to India, Myanmar, Vietnam, Malay Peninsula and Sri Lanka. The plant name has been checked with http://www.worldfloraonline.org (December 2022). Biancaea sappan (L.) Tod. used in traditional Chinese medicine (TCM) possesses a wide range of medicinal characteristics and is traditionally used to treat a wide range of illnesses, such as anti-inflammatory^{[4, 5]}, improve blood circulation^{[6, 7]}, regulate immunity^[8], anti-cancer ^[9], antioxidant properties^[10], and hypoglycemic^[11]. The traditional use of the herbal drug is closely aligned with the effect studied.The main ingredient isolated from traditional herbal medicine is called Brazilin (7, 11b-dihydrobenz[b]indeno[1,2-d]pyran-3,6a,9,10 (6H)-tetrol). Brazilin is a potential antithrombotic medicine by targeting collagen receptors^[12]. Brazilin is a powerful inhibitor of α-syn fibrillogenesis and the cytotoxicity it stimulates^[13]. Brazilin continues to hold promise as a treatment for severe inflammatory skin conditions^[14]. Brazilin dramatically increases the expression of the genes c-Fos and GADD45β while having a strong inhibitory effect on bladder cancer T24 cells ^[15]. In vitro and in vivo, Brazilin inhibited the nuclear translocation of the nuclear factor kappa-B (NF-κB) p65 subunit. By reducing hypoglycemia, inflammation, and ECM formation and enhancing NF-κB p65-dependent autophagy by activating ROS signaling pathways in HNSCC, Brazilin may be an effective treatment for DN^{[16, 17]}. Although Brazilin has been confirmed to have the above traditional effects, its regulatory effect on immune inflammatory response in AS remains unclear.

Brazilin has anti-inflammatory properties through a series of complex processes, including the reduction of NO production, influence of NF-κB and activator protein-1 in RAW 264.7 cells, induction of haem oxygenase-1 expression, and suppression of PGE2, TNF-α, and IL-1β production^[18]. Brazilin affects atherosclerosis, however the exact way is yet unclear. As a more useful and appropriate model to investigate Brazilin's inhibitory effect on AS, THP-1 cells were selected.

One of the most frequently mentioned important promoters of numerous atherosclerotic processes is toll-like receptor 4 (TLR4)^[19]. TLR4 overexpression can cause an excessive release of proinflammatory cytokines and chemokines such tumour necrosis factor (TNF)-α, interleukin (IL)-1, IL-6, and type-I interferon (IFN)-α as it is an activator of a number of inflammatory cascades in an NF-κB-dependent manner^{[20, 21]}.

Moreover, Brazilin has also been shown to inhibit the vascular inflammatory response through the TLR4/NF-κB signalling pathway^{[22, 23]}. NF-κB signalling plays a crucial role in the inhibition of LPS-induced inflammatory responses. LPS has the potential to stimulate the NF-κB signaling pathway, promote the release of inflammatory cytokines, and result in inflammation. Brazilin's ability to prevent NF-κB from functioning is directly related to its anti-inflammatory characteristics^[23]. NF-κB binding sites on the promotor that closely regulate MMP-9 transcription in response to various extracellular stimuli, such as TNF-α and IL-1β, can influence MMP-9 gene expression^[24].

The transcriptional regulation of inflammatory cytokines mediated by NF-κB after short-term exposure was the central focus of early investigations of Brazilin due to its inhibitory action on NF-κB. For the purpose of preventing inflammatory harm in AS, we postulated that Brazilin would be a useful therapeutic drug. We also looked into potential underlying mechanisms involving the TLR4/NF-κB/MMP-9 pathways. The mechanism underlying PD-1's anti-inflammatory properties is unclear. Therefore, this study aims to investigate Brazilin's anti-inflammatory and immunoregulatory effects on THP-1 cells generated by LPS.

Phorbol myristate acetate (PMA, MCE) was used to induce the extension of pseudopodia and form macrophages. According to the manufacturer's instructions, LPS (Sigma-Aldrich, USA) was diluted in sterile, endotoxin-free phosphate-buffered saline (PBS, Sigma-Aldrich). In this study, THP-1 cells were exposed to 500 ng/ml LPS for 24 hours to induce inflammatory damage.

2.1. Cell Culture and treatments

2.1.1. Cell culture

At 37°C and 5% CO₂ in a humid incubator, cells were grown in Roswell Park Memorial Institute-1640 culture media (RPMI 1640, Biological Industries, Israel) supplemented with 6% heat-inactivated foetal bovine serum (Gibco, USA).

2.1.2. Inflammatory model

The complete culture containing 100 ng/mL PMA was used to resuspend normal THP-1 cells after they had been collected, centrifuged to remove the supernatant, and resuspended. In 96-well plates (MCE), THP-1 cells were seeded at a density of 5× 10⁵ mL, and LPS (500 ng/mL) was added for 24 hours. Morphologically, THP-1 cells were elliptical, fusiform or had protruding pseudotypes under an inverted fluorescence microscope (40 x magnification). THP-1 cells became adherent and turned into macrophages.

2.1.3. Drug treatment

In 96-well plates, THP-1 cells were seeded at a density of 5 10⁵/mL in the presence of LPS (500 ng/mL) with or without different concentrations of sterile-filtered Brazilin (purity 98.0%, Targetmol, China) and simvastatin (MCE, USA) for 24 h and 48 h.

2.2. Cell viability assay

Cell viability was assessed using the CCK-8 test. The whole media was mixed with 100 ng/mL PMA after the normal THP-1 cells had been collected, centrifuged to remove the supernatant, and resuspended. THP-1 cells were seeded at a density of 5*10⁵ cells/well for 24 hours into 96-well plates (MCE, USA). There was a 200µL total volume. The media was taken away after 24 hours, and the cells were then given 500 ng/mL LPS for 24 hours. After that, each well received 10 µL of the CCK-8 (MCE, USA) reagent, which was then incubated for 24 hours at 37°C. The controls included naive cells and medium alone. Different concentrations of Brazilin (0 ~ 220 µg/mL) and simvastatin (0 ~ 220 µg/mL) were used. After 24 and 48 hours, the proliferation of THP-1-derived macrophages was investigated. Using a microplate reader (Bio-Tek Epoch, USA), the spectrophotometric absorbance was determined at a wavelength of 450 nm Cell viability (%) was calculated as a percentage of the control group's viability, which was assumed to be 100%. The following formula was used to compute the cytotoxicity, which was expressed as a percentage of cell death: (1− [absorbance of experimental wells/absorbance of control wells]) × 100%.

2.3. Flow cytometry

Three days were spent incubating THP-1-derived macrophages in the presence or absence of various quince peel polyphenol concentrations. PE anti-human CD279 (PD-1) was used to label the cells, and a FACS Aria II flow cytometer (Becton Dickinson, USA) was used to measure expression. It was quantified how many PD-1-positive cells were present in each group.

2.4. Quantitative reverse transcriptase PCR (qRT‒PCR)

According to the manufacturer's instructions, the total RNA of the treated THP-1 cells was extracted using a Takara Mini Best Universal RNA Extraction Kit (Takara, China). The PrimeScript RT reagent kit with gDNA Eraser (perfect real time) was used to reverse transcribe cDNA (Takara, China). According to the manufacturer's instructions, Light Cycler 480 SYBR Green I Master Mix (Roche, China) was used to measure the expression of MMP-9, TLR4, and PD-1 in THP-1 cells. The temperatures for the 40 cycles of the PCR procedure were 95°C for 10 s, 60°C for 15 s, and 72°C for 20s. The software GraphPad Prism 8 was used to analyze the qRT-PCR results. As an endogenous control, GAPDH expression was examined in each sample.

Table 1

**Primer sequence table**
Gene name		5’-3’ Sequence	Size
GAPDH	Forward	TCAAGAAGGTGGTGAAGCAGG	115 bp
	Reverse	TCAAAGGTGGAGGAGTGGGT
PD-1	Forward	GTGACAGAGAGAAGGGCAGA	247 bp
	Reverse	GCTCCCCATAGTCCACAGAG
TLR4	Forward	GTGCCTCCATTTCAGCTCTG	151 bp
	Reverse	CAAAGATACACCAGCGGCTC
NF-κB	Forward	CTGAACCAGGGCATACCTGT	197 bp
	Reverse	GAGAAGTCCATGTCCGCAAT
MMP-9	Forward	CGCTACCACCTCGAACTTTG	197 bp
	Reverse	TGCCATTCACGTCGTCCTTA

2.5. Western blot analysis

RIPA buffer was used to lyse the cells on ice for 30 minutes. The volume of lysate was adjusted to the protein concentration using the BCA method, and 5× SDS loading buffer was added. This mixture was then heated for 5 minutes at 100°C. Sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS-PAGE)was used to separate the extracted proteins, and the separated proteins were then electrotransferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked for 1 hour at room temperature in TBST containing 5% nonfat dry milk. Prior to being exposed to secondary antibodies coupled to horseradish peroxidase (HRP), the membranes were first treated with primary antibodies against PD-1, TLR4, NF-κB, MMP-9, and GAPDH. Using a chemiluminescence reaction and ECL reagents from Amersham Pharmacia Biotech, immunocomplexes were seen.

2.6. Statistical analysis

In this study, every experiment was run in duplicate and at least three times. Software called SPSS 22.0 was used to do the statistical analysis. The means and SD of data from numerous experiments are presented. Student's t tests were used to compare statistics between two groups. When comparing three or more groups, one-way ANOVA was employed before the Tukey's multiple comparison test.With a P value of 0.05, the observations were deemed statistically significant.

3.1. Determination of optimum drug concentration

The effects of drugs on the THP-1-cell survival was measured by the CCK-8 method after the cells were cultures to the logarithmic growth stage. THP-1 macrophages had a 50% survival rate when the Brazilin concentration was 12.7 µg/mL and the simvastatin concentration was 15 µg/mL. When the Brazilin concentration was greater than 18 µg/mL, the cell survival rate did not change much. The best concentration of simvastatin was 15 µg/mL, and growth was concentration dependent.The results showed that the effect at 24 h was more obvious than at 48 h. When the treatment time with Brazilin and simvastatin was 48 h, the survival rate was more than 50%, which is not conducive to cell growth and subsequent experiments.

3.2. Cytokine expression assay

Levels of TNF-α and IL-10 were found using ELISA, and the Results demonstrated that the medication group's TNF-α concentrations were considerably lower; compared with the model group, the three drug groups had a very significant difference (P < 0.001). Simvastatin, Shenxiaheji, and Brazilin group differences were all very statistically significant (P < 0.001). The Shenxiaheji group and the Brazilin group did not significantly differ from one another.; The drug group had higher IL-10 concentrations than the control group, and there was a statistically significant difference between the Simvastatin, Shenxiaheji, and Brazilin groups as compared to the Model group (P < 0.001). Simvastatin and Shenxiaheji groups' comparison revealed a statistically significant difference (P < 0.001), but there was no statistical significance when Brazilin was included.

3.3. Quantitative reverse transcriptase PCR (qRT‒PCR)

The mRNA expression levels of PD-1, NF-κB, TLR4 and MMP-9 were measured by qRT‒PCR. The findings demonstrated that there was a very significant difference between the experimental groups and the Model group. The test groups did not differ significantly in terms of PD-1 mRNA expression, although there was a statistically significant difference (P < 0.05) between the Simvastatin and Brazilin groups. In terms of TLR4 mRNA expression, there was no discernible change between the Simvastatin and Brazilin groups.

3.4. Western blot analysis

Western blotting was used to find the levels of PD-1, NF-B, TLR4, and MMP-9 protein expression. The expression of MMP-9 in the medication groups was significantly different from the model group (P < 0.001) in comparison. The differences in PD-1 and MMP-9 among the different experimental groups were highly statistically significant (P < 0.001). Simvastatin considerably increased the expression of TLR4 and dramatically decreased the expression of NF-κB when compared to Brazilin (P < 0.001). Simvastatin also significantly increased the expression of NF-κB when compared to Brazilin (P < 0.001).

3.5. Flow cytometry

Flow cytometry was used to detect the expression of PD-1. Compared with the model group, the expression of PD-1 on the cell surface in all three groups was reduced. Compared with the control group, the differences in the Brazilin group and the simvastatin group were significant (P < 0.01; P < 0.001; P < 0.001).

Despite strict cholesterol control, patients still have high rates of atherosclerosis. In autoimmune disorders like cardiovascular disease, immune checkpoint proteins are effective targets that modulate immunity^{[25, 26]}. Atherosclerosis is significantly cured by TCM. It has been noted that Sappan Lignum, the heart wood of C. sappan, exhibits anti-inflammatory, antiproliferative, and antioxidant activities ^[1]. This TCM remedy is used to treat a variety of illnesses. Brazilin, the primary constituent of C. sappan, has been demonstrated to have anti-inflammatory properties in the past ^[27]. Brazilin's anti-atherosclerotic impact on immunity, however, has not yet been demonstrated.

Although several studies have confirmed that Brazilin exerts anti-inflammatory effects^{[18, 28]}, although most of these studies concentrated on Brazilin's impact on the expression of proinflammatory cytokines and inflammatory mediators rather than PD-1.

LPS, the major component of the Gram-negative bacterial cell wall, is a natural ligand of TLR4^[29]. LPS is expressed and released, causing an inflammatory response. New anti-inflammatory drugs for atherosclerosis have been extensively tested using cell-based atherosclerosis models produced by LPS^{[30, 31]}.

Therefore, we hypothesized that there was an association between the anti-atherosclerotic effect of Brazilin with PD-1 levels. Here, we provide evidence that Brazilin is the main component of sappan wood and could markedly inhibit atherosclerosis exacerbation induced by LPS in THP-1 cells. To address this hypothesis, LPS was used to activate THP-1 cells, and Brazilin was added at the recommended concentrations or left out. When compared to the LPS-treated groups, there was a clear drop in PD-1 mRNA (Fig. 3A) and protein levels (Fig. 5A) after exposure to Brazilin. Brazilin also markedly decreased the levels of PD-1 mRNA (Fig. 3A). Brazilin administration also reduced the expression of the PD-1 protein that was brought on by LPS (Fig. 5A). These findings led us to the conclusion that Brazilin reduced the expression of PD-1, NF-κB, TLR4, and MMP-9 in order to decrease LPS-induced THP-1-cell inflammation.

We showed that LPS induced immune inflammatory responses in macrophages by driving inflammatory pathways, leading to changes in various cytokines, and there was evidence for a proinflammatory priming state in differentiated macrophages. Our findings implicated PD-1 as a mediator of immunity. Pharmacological inhibition of Brazilin abolished these effects of LPS-induced immunity in vitro.

THP-1 cells showed increased release of IL-10 in response to Brazilin (Fig. 2B), suggesting that PD-1 was sufficient for Brazilin-mediated induction of IL-10 secretion. Brazilin significantly reduced TNF-α secretion. PD-1, NF-κB, TLR4 and MMP-9 mRNA and protein expression were also induced by Brazilin.

The majority of the inflammatory cells in atherosclerotic plaques are macrophages. A variety of proinflammatory cytokines and inflammatory chemokines, such as MCP-1, IL-8, and MIP-3, are produced by activated macrophages, which promotes inflammation during atherosclerosis^[32]. According to earlier studies, ApoE^−/− mice lacking TLR4 have lower levels of plaque lipids, macrophages, and proinflammatory cytokines, which suggests a pathophysiological connection between immunology and atherosclerosis ^[33]. Our findings suggest that PD-1 stimulation may be used as a therapeutic to slow the progression of atherosclerosis in light of current developments in immune regulation as a means of treating the disease^[34].Thus, the inhibition of PD-1 by Brazilin may lead to a reduction in NF-κB, TLR4 and MMP-9 activation in vivo.

In addition to stimulating efferocytosis, Brazilin may downregulate TNF-α in PMA-stimulated THP-1 cells. This would verify Brazilin as a therapeutic agent that reduces inflammatory pathologies such as atherosclerosis. Similarly, Brazilin alters the secretion of the proinflammatory cytokines IL-6 and TNF-α and the anti-inflammatory cytokine IL-10, and has the strongest anti-inflammatory effect on RAW 264.7 macrophages.^[18].

TLR4 is a particular LPS receptor, and its absence reduces the development of atherosclerotic plaque ^{[35, 36]}. Atherosclerosis is lessened by reducing the LPS-induced NF-κB signaling since NF-κB is a recognized important downstream effector ^[37].

Brazilin can inhibit the abnormal activation of PD-1, TLR4, NF-κB and MMP-9 and is a good anti-AS drug that can not only reduce blood lipids but also have immunoregulatory and anti-inflammatory activity, laying a solid theoretical foundation for future screening and development of anti-AS drugs. In particular, Brazilin has an obvious regulatory effect on PD-1 related inflammatory immune response, which is expected to provide a new target and direction for future treatment.

LPS, lipopolysaccharide; TNF-α, tumour necrosis factor alpha; TLR4, toll-like receptor 4; AS, atherosclerosis; NF-κB, nuclear factor kappa-B; PMA, phorbol myristate acetate; PBS, phosphate-buffered saline; TCM, traditional Chinese medicine; RPMI 1640, roswell park memorial institute-1640.

Acknowledgements

All the authors have accepted responsibility for the entire contents of this submitted manuscript and approved submission.

Author contributions

We are grateful to Lucheng Song for technical support. We thank Shanmei Sun and Yameng Zhang for coordinating the constant collection and Tong Ma for taking care of the cells.

Funding

Project Description of TCM Science and Technology Development Plan of Shandong Province（2019-0373）

Declaration of competing interest

The authors declare that there are no conflicts of interest.

Jayakumar T, Chang CC, Lin SL, et al. Brazilin ameliorates high glucose-induced vascular inflammation via inhibiting ros and cams production in human umbilical vein endothelial cells [J]. Biomed Res Int, 2014,2014(403703.
Tardif JC, Kouz S, Waters DD, et al. Efficacy and safety of low-dose colchicine after myocardial infarction [J]. N Engl J Med, 2019,381(26):2497-2505.
Man JJ, Beckman JA, Jaffe IZ. Sex as a biological variable in atherosclerosis [J]. Circ Res, 2020,126(9):1297-1319.
Tewtrakul S, Tungcharoen P, Sudsai T, et al. Antiinflammatory and wound healing effects of caesalpinia sappan l [J]. Phytotherapy research : PTR, 2015,29(6):850-856.
Chu M, Wang Y, Itagaki K, et al. Identification of active compounds from caesalpinia sappan l. Extracts suppressing il-6 production in raw 264.7 cells by pls [J]. Journal of ethnopharmacology, 2013,148(1):37-44.
Chang Y, Huang S, Lu W, et al. Brazilin isolated from caesalpinia sappan l. Acts as a novel collagen receptor agonist in human platelets [J]. Journal of biomedical science, 2013,20(1):4.
Guo J, Li L, Wu Y, et al. Inhibitory effects of brazilin on the vascular smooth muscle cell proliferation and migration induced by pdgf-bb [J]. The American journal of Chinese medicine, 2013,41(6):1283-1296.
Ye M, Xie W, Lei F, et al. Brazilein, an important immunosuppressive component from caesalpinia sappan l [J]. International immunopharmacology, 2006,6(3):426-432.
Wang X, Xiu Z, Du Y, et al. Brazilin treatment produces antidepressant- and anxiolytic-like effects in mice [J]. Biological & pharmaceutical bulletin, 2019,42(8):1268-1274.
Hwang H, Shim J. Brazilin and caesalpinia sappan l. Extract protect epidermal keratinocytes from oxidative stress by inducing the expression of gpx7 [J]. Chinese journal of natural medicines, 2018,16(3):203-209.
Pattananandecha T, Apichai S, Julsrigival J, et al. Caesalpinia sappanantibacterial activity against foodborne pathogens and inhibitory effect on anti-inflammatory mediators' production of brazilin-enriched extract from linn [J]. Plants (Basel, Switzerland), 2022,11(13).
Chang Y, Huang S, Lu W, et al. Brazilin isolated from caesalpinia sappan l. Acts as a novel collagen receptor agonist in human platelets [J]. Journal of biomedical science, 2013,20(4.
Liu F, Wang Y, Sang J, et al. Brazilin inhibits α-synuclein fibrillogenesis, disrupts mature fibrils, and protects against amyloid-induced cytotoxicity [J]. Journal of agricultural and food chemistry, 2019,67(42):11769-11777.
Di Paolo CT, Filippou PS, Yu Y, et al. Screening of chemical libraries in pursuit of kallikrein-5 specific inhibitors for the treatment of inflammatory dermatoses [J]. Clin Chem Lab Med, 2019,57(11):1737-1743.
Zhang T, He J, Zhang S, et al. Brazilin induces t24 cell death through c-fos and gadd45beta independently regulated genes and pathways [J]. IUBMB Life, 2018,70(11):1101-1110.
Li ZY, Zheng Y, Chen Y, et al. Brazilin ameliorates diabetic nephropathy and inflammation in db/db mice [J]. Inflammation, 2017,40(4):1365-1374.
He Z, Zhu F, Li S, et al. Inhibiting ros-nf-κb-dependent autophagy enhanced brazilin-induced apoptosis in head and neck squamous cell carcinoma [J]. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 2017,101(55-66.
Mueller M, Weinmann D, Toegel S, et al. Compounds from caesalpinia sappan with anti-inflammatory properties in macrophages and chondrocytes [J]. Food Funct, 2016,7(3):1671-1679.
Li Y, Wang Y, Chen Y, et al. In vitrocorilagin ameliorates atherosclerosis in peripheral artery disease via the toll-like receptor-4 signaling pathway and [J]. Frontiers in immunology, 2020,11(1611.
Gay N, Symmons M, Gangloff M, et al. Assembly and localization of toll-like receptor signalling complexes [J]. Nature reviews Immunology, 2014,14(8):546-558.
Satoh M, Shimoda Y, Maesawa C, et al. Activated toll-like receptor 4 in monocytes is associated with heart failure after acute myocardial infarction [J]. International journal of cardiology, 2006,109(2):226-234.
Kang K, Won M, Yuk JM, et al. Iinq attenuates systemic inflammatory responses via selectively impairing the myddosome complex formation upon tlr4 ligation [J]. Biochem Pharmacol, 2016,121(52-66.
Chen J, Zhang M, Zhu M, et al. Paeoniflorin prevents endoplasmic reticulum stress-associated inflammation in lipopolysaccharide-stimulated human umbilical vein endothelial cells via the ire1α/nf-κb signaling pathway [J]. Food & function, 2018,9(4):2386-2397.
Heidinger M, Kolb H, Krell HW, et al. Modulation of autocrine tnf-alpha-stimulated matrix metalloproteinase 9 (mmp-9) expression by mitogen-activated protein kinases in thp-1 monocytic cells [J]. Biol Chem, 2006,387(1):69-78.
O'Neill R, Cao X. Co-stimulatory and co-inhibitory pathways in cancer immunotherapy [J]. Advances in cancer research, 2019,143(145-194.
Douna H, Amersfoort J, Schaftenaar F, et al. B- and t-lymphocyte attenuator stimulation protects against atherosclerosis by regulating follicular b cells [J]. Cardiovascular research, 2020,116(2):295-305.
Syamsunarno M, Safitri R, Kamisah Y. Caesalpinia sappanprotective effects of linn. And its bioactive compounds on cardiovascular organs [J]. Frontiers in pharmacology, 2021,12(725745.
Nava-Tapia D, Cayetano-Salazar L, Herrera-Zúñiga L, et al. Brazilin: Biological activities and therapeutic potential in chronic degenerative diseases and cancer [J]. Pharmacological research, 2022,175(106023.
Zhao D, Jiang Y, Sun J, et al. Elucidation of the anti-inflammatory effect of vanillin in lps-activated thp-1 cells [J]. J Food Sci, 2019,84(7):1920-1928.
Lund M, To J, O'Brien B, et al. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of thp-1 macrophages to a pro-inflammatory stimulus [J]. Journal of immunological methods, 2016,430(64-70.
Chanput W, Mes JJ, Wichers HJ. Thp-1 cell line: An in vitro cell model for immune modulation approach [J]. Int Immunopharmacol, 2014,23(1):37-45.
Qiao L, Chen W. Atheroprotective effects and molecular targets of bioactive compounds from traditional chinese medicine [J]. Pharmacological research, 2018,135(212-229.
Michelsen K, Wong M, Shah P, et al. Lack of toll-like receptor 4 or myeloid differentiation factor 88 reduces atherosclerosis and alters plaque phenotype in mice deficient in apolipoprotein e [J]. Proceedings of the National Academy of Sciences of the United States of America, 2004,101(29):10679-10684.
Ridker P, Everett B, Thuren T, et al. Antiinflammatory therapy with canakinumab for atherosclerotic disease [J]. The New England journal of medicine, 2017,377(12):1119-1131.
Lu Z, Zhang X, Li Y, et al. Tlr4 antagonist reduces early-stage atherosclerosis in diabetic apolipoprotein e-deficient mice [J]. The Journal of endocrinology, 2013,216(1):61-71.
Curtiss L, Tobias P. Emerging role of toll-like receptors in atherosclerosis [J]. Journal of lipid research, 2009:S340-345.
Kim S, Park J, Kim K, et al. Melittin inhibits atherosclerosis in lps/high-fat treated mice through atheroprotective actions [J]. Journal of atherosclerosis and thrombosis, 2011,18(12):1117-1126.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Brazilin inhibits the inflammatory immune response induced by LPS in THP-1 cells

Status:

Version 1

Abstract

Objective

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials And Methods

2.1. Cell Culture and treatments

2.1.1. Cell culture

2.1.2. Inflammatory model

2.1.3. Drug treatment

2.2. Cell viability assay

2.3. Flow cytometry

2.4. Quantitative reverse transcriptase PCR (qRT‒PCR)

2.5. Western blot analysis

2.6. Statistical analysis

3. Results

3.1. Determination of optimum drug concentration

3.2. Cytokine expression assay

3.3. Quantitative reverse transcriptase PCR (qRT‒PCR)

3.4. Western blot analysis

3.5. Flow cytometry

4. Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1