Animals
This study used young 8-week-old wild-type CD1 mice subjected to MCAO as described below. Mice were bred at the Animal Facility of IFC-UNAM, certified by the Secretariat of Agriculture and Rural Development (SADER-Mexico). Animals were housed in individual cages in a 12-h light/12-h dark cycle with food and water ad libitum. Mice were killed at 16 days post-stroke. All experimental procedures were conducted under the current Mexican law for the use and care of laboratory animals (NOM-062-ZOO-1999) with the Institutional Animal Care and Use Committee approval (CICUAL-IFC-LTR93-16). Experiments are reported in compliance with the Updated Animal Research: Reporting In Vivo Experiments (ARRIVE 2.0) guidelines. 30
Study design
For the in vivo experiments, the sample size used was determined a priori based on pilot experiments. Considering a medium Cohen's d effect size > 0.3, statistical b power of 0.8, and significance of 0.05, we determined that n = 5 would allow us to reject the null hypothesis with 95% confidence. The mortality rate was assumed to be 0.5 based on pilot experiments. The inclusion criteria consider the analysis of experiments that recapitulate complete ischemia/reperfusion without brain hemorrhagia. An experiment met the inclusion criteria when there was a reduction of blood perfusion below 50% of baseline, which roughly corresponds to the effect of occluding the common carotid artery, reperfusion above 50% baseline within 10 min, total occlusion time of 40 min, absence of subarachnoid or intraparenchymal hemorrhages, and survival for 24 h after stroke. For humane reasons, experiments were terminated when animals presented with hemiplegia or generalized weakness that made them unable to eat or drink autonomously within 24 h of stroke; those animals were considered dead before 24 h.
Adult neural progenitor cells
NPCs were obtained from the subventricular zone of 8-week-old male CD1 mice. Animals were killed by cervical dislocation followed by decapitation. The brains were collected in ice-cold Hank's balanced salt solution (HBSS, Invitrogen), and the SVZ of the lateral ventricles was dissected under a stereoscopic microscope. Tissue from four mice was pooled for each culture. Dissected tissues were minced and incubated with TrypLE Express (Invitrogen) for 5 min at 37°C. Then, an equal volume of Neurobasal medium (Gibco) was added, and the tissue was mechanically disaggregated with a fire-polished Pasteur pipet tip. The cell suspension was passed through a 40 µm-pore cell strainer and subsequently centrifugated at 300 × g for 3 min. The pellet was resuspended in Neurobasal + B27 supplemented with 20 ng/ml recombinant epidermal growth factor (EGF; Preprotech, 400 − 25) and 10 ng/ml recombinant basic fibroblast growth factor (bFGF; Preprotech, 450 − 33). After 3–4 DIV, neurospheres began to grow in suspension; when spheres reached 150–200 µm in diameter (5–7 DIV), they were dissociated by enzymatic digestion with TrypLE Express at 37°C for 3 min, then the number of viable cells was estimated by trypan blue exclusion, and cells were plated at a density of 8000 cells/cm2 in poly-D-lysine/laminin-coated T75 flasks. NPCs were used at passage ≤ 5 in all experiments.
Oxygen and glucose deprivation
Under some experimental conditions, the cells were subjected to oxygen and glucose deprivation (OGD). For this, cultured cells underwent a complete medium change to DMEM:F12 without glucose and pyruvate (GIBCO) and were incubated inside a hypoxic chamber (StemCell Technologies, Cambridge, MA) with a 100% N2 atmosphere for 2 h at 37°C. Following this period, the cells were put back in Neurobasal media supplemented with B27 and incubated under normoxic conditions for 22 h.
The molecular response to OGD in NPCs was corroborated by analyzing Western blot's expression of the hypoxia-inducible factor α. For this, 10 µg of whole cell lysates were resolved by 7.5% PAGE and transferred to a PVDF membrane that was probed with a mouse primary monoclonal antibody (1:200, Santa Cruz; sc-13515) and an HRP-conjugated goat anti-mouse antibody (1:5000, GeneTex; GTX213111-01) Following incubation with the Immobilon forte substrate (EMD Millipore), the blot was exposed to a photographic film (Kodak). In addition, the expression of VEGF mRNA was assessed by RT-PCR. Total RNA was extracted from NPC with TRIzol (Invitrogen, Carlsbad, CA) for this. An amount of 1 µg was reverse transcribed to cDNA, and an aliquot of 1 µl of cDNA was used as a template for RT-PCR using an Applied Biosystems system with the following parameters: VEGF forward primer: 5' GGCCTCCGAAACCATGAACT3', reverse primer − 5' GTCCACCAGGGTCTCAATCG 3' that amplify a product of 141 bp; GAPDH forward primer 5′-GCATCTTCTTGTGCAGTGCC-3' and reverse primer 5′-GATCTCGCTCCTGGAAGATGG-3' that amplify a product of 278 bp. Thermocycling conditions were melting at 95°C for 30 s; anneal at 63.5°C (VEGF 27 cycles) for 45s, or 57°C (GAPDH 25 cycles) for 30 s; extension at 72°C for 30 s. The PCR products were analyzed by electrophoresis in a 2% agarose gel. The relative RNA amount was calculated by densitometry using Image J.
Immunofluorescence
Neurospheres were allowed to sediment on poly-D-lysine/laminin-coated coverslips. Cells were fixed with ice-cold paraformaldehyde (4%, w/v) for 20 min, then permeabilized with 0.25% Triton X-100 for 5 min, blocked with 5% normal goat serum, and incubated overnight at 4°C with anti-nestin (1:500, Thermo Scientific, PA5-17428) and anti-doublecortin (1:1000, Thermo Scientific, 2Q178) antibodies. Then, cells were incubated with Alexa Fluor 488-conjugated anti-rabbit (1:500, Life technologies) and Alexa Fluor 546-conjugated anti-mouse (1:500, Life technologies) antibodies at RT for 1 h, and the nuclei were counterstained for 5 min with 4′,6-diamidino-2-phenylindole (DAPI). Immunofluorescence was visualized using a Zeiss LSM 800 II Microscope.
Luciferase assay
Following the manufacturer instructions, NPCs were transfected with HRE-luciferase and pEGFP-N1 plasmids with the mouse NSC nucleofector kit (Lonza, Basel, Switzerland). HRE-luciferase was a gift from Navdeep Chandel (Addgene plasmid #26731; RRID: Addgene_26731)31, and pEGFP-N1 was a gift from Félix Recillas (IFC-UNAM). Forty-eight hours post-transfection, the cell cultures were subjected to OGD for 2 h. They were lysed, and luciferase activity was determined in a luminometer (Turner Biosystems, Promega) with the luciferase Assay System (Promega, Madison, WI) at different time points after recovery. The number of GFP-positive cells was used to normalize for transfection efficiency.
EV isolation and quantitation
The conditioned media of NPCs cultured in monolayers was collected after 12 h, then cell debris and apoptotic bodies were removed by centrifugation at 500 × g at 10 min. Conditioned media was then filtered with a 0.2 µm pore filter and subsequently ultracentrifuged at 50,000 × g for 30 min; the supernatant was further ultracentrifuged at 100,000 × g for 4 h (4°C). The isolated EV pellets were resuspended in 100 µl PBS and stored at -80°C until used. EV size, distribution, and concentrations were determined as previously reported 17 using an NS300 NanoSight nanoparticle tracking analysis system (Malvern Instruments). Data were binned and plotted as a continuous histogram.
Transmission Electron Microscopy
Two µL of EV suspension were loaded onto glow-discharged 400 mesh copper/carbon-coated grids and left to settle for 5 min. After a brief wash with drops of distilled water, the grids were stained in 2% uranyl formate for 1 min and blow-dried on Whatman filter paper. Exosomes were examined with a JEOL-JEM-1200 Transmission Electron Microscope at an accelerating voltage of 80 keV.
Cortical neuron cultures
Cortical neuronal cultures were prepared as previously described 15. E17 rat cortices were isolated, trypsinized, and dissociated in Ca2+ and Mg2+ free HBSS (Gibco, Carlsbad, CA). Neurons were plated at a density of 1.3×105 cells/cm2 in polyethyleneimine-coated 24-well plates in Neurobasal medium supplemented with B-27 (Gibco) and 1% antibiotic/antimycotic solution (104 U of penicillin G/ml, 10 mg of streptomycin/ml, and 25 µg of amphotericin B/ml) (Sigma). Cytosine β –D-arabinofuranoside (2.5 µM; Sigma) was added on DIV 3 to prevent the proliferation of astrocytes.
For neuronal death-inducing stimuli, neuronal cultures were incubated on DIV 11 with 10 µM N-methyl-D-aspartate (NMDA) (Tocris) + 1 µM glycine (Sigma), 10 µM 4-hydroxynonenal (Sigma), or 10 nM staurosporine (Sigma) for 24 h. OGD was induced by replacing the conditioned media for glucose and pyruvate-free medium and incubating the cells in a hypoxia chamber (StemCell Technologies, Cambridge, MA) with a 100% N2 atmosphere for 1 h, at the end of the OGD period, cells were switched to normal Neurobasal + B27 and placed in a ̴ 21% O2 atmosphere. In the indicated experiments, NPC-EVs with a total amount of 800 ng of protein/mL were added to neuronal cultures for 24 h in combination with the death indicing stimuli, or after OGD.
Assessment of neuronal viability
Neuronal viability was determined as previously described by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction 15. Briefly, the neurons were incubated with 0.1 mg/mL MTT for 2 h at 37°C at the end of the analyzed period. Media was removed, and formazan precipitations were dissolved in 4 mM HCl isopropanol. The absorbance of cell debris-free supernatants was read in a spectrophotometer (Beckman Coulter) with a 570 nm wavelength. Data are presented as a percentage relative to the absorbance of control conditions. In some experimental conditions, we corroborated neuronal viability with the life/dead fluorescence assay (Abcam; 176749, Cambridge, MA) that stain live cells with CytoCalcein AM (green), necrotic cells with 7-aminoactinomycin D (7-AAD; red), and apoptotic cells with apopxin (magenta), following manufacturer's directions.
Middle cerebral artery occlusion
Young adult (8 weeks old; 25 g) CD1 mice were put under anesthesia with xylazine (10mg/kg i.p., PISA, Guadalajara, Mexico) and maintained anesthetized with ≤ 1.5% isoflurane (VetOne, Boise, ID) for the duration of the procedure with oxygen as the carrier. Normal ventilation was autonomously maintained. A nylon monofilament with a silicone-dipped tip (602156/602256, Doccol, Sharon, MA) was inserted in the ligated left external carotid artery and intraluminally advanced through the internal carotid artery until it occluded the MCA. The occlusion was kept for 40 min, after which the monofilament was removed. Body temperature was maintained at 37°C with a heating pad. At the end of the procedure, the neck skin was sutured, and mice were returned to their cages. During the entire experimental procedure, the cerebral blood flow (CBF) was monitored in the territory irrigated by MCA with laser-Doppler flowmetry monitored at the following stereotaxic coordinates; AP -1, L + 5 from Bregma, with a laser-Doppler probe (model 407, Perimed, Järfälla, Sweden) connected to a Periflux System 5010 (Perimed). CBF was continuously monitored with an acquisition interval of 0.3 s using the Perisoft software (Perimed).
Administration of NPC-derived exosomes in vivo
A fixed volume of 2 µl of an exosome suspension in phosphate buffer was administered by intracerebroventricular (i.c.v.) injections in the contralateral lateral ventricle in the corresponding animal groups with the following stereotaxic coordinates: AP + 0.5, L + 1.1 from Bregma and V + 2 from dura matter. i.c.v. administrations were done 30 min after intraluminal filament removal, marking the beginning of reperfusion. A second administration was done on day two post-stroke. Injections were performed with graduated glass microcapillary pipettes (Drummond Scientific Company; Broomall, PA) that were pulled to produce a tip < 50 µm diameter at a flux rate of 0.8 µL/min. The number of exosomes administered in each experiment contained equal quantities of total protein in the range of 800 ng.
Neurogenesis inhibition in vivo
Four percent cytosine-β-D-arabinofuranoside (Ara-C; Sigma) in 0.9% NaCl or vehicle was administered i.c.v. with an Alzet osmotic minipump (model 1002, Durect Co, Cupertino, CA) at a flux rate of 0.25 µl/h for 16 d, starting on day 4 after stroke. Minipumps were connected to an i.c.v. cannula implanted on the skull at stereotaxic coordinates AP + 0.5, L + 1.1 from Bregma, and V + 2 from dura matter. Bromodeoxyuridine (BrdU; 50 mg/kg, Sigma) was injected i.p. daily from day 12 to 16 post-MCAO.
For immunohistological analyses of BrdU+ cells, animals were transcardially perfused with 10 mL ice-cold 0.9% NaCl followed by 10 mL ice-cold 4% paraformaldehyde (PFA). The brains were collected and post-fixed in 4% PFA for 24 h and then cryoprotected in 30% sucrose. Whole PFA-fixed brains were cut into 40 µm thick sections in a cryostat to produce ten series of consecutive sections 400 µm apart. Sections were washed in 1X PBS + 0.1% Tween 20 (PBST) for 10 min following antigen retrieval in 50% formamide in 2× saline-sodium citrate buffer (SSC; 300 mM NaCl, 30 mM sodium citrate) for 1 h at 65°C, washed twice with SSC at RT 10 min each, and incubated with HCl 2N for 5 min at RT. Next, sections were incubated in 0.1 M boric acid for 10 min and washed for 10 min with PBST twice. Brain sections were blocked with 5% goat serum, 0.5% Triton X-100, 1% BSA, 50 mM glycine in PBST for 2 h at RT, incubated with primary antibody anti-BrdU (1:200; Sigma) in PBST with 10 mM glycine and 1% DMSO overnight at 4°C and washed thrice with PBST for 10 min each. A secondary anti-mouse antibody conjugated with Alexa Fluor 488 (1:500, Invitrogen) was incubated in PBST overnight at 4°C and washed twice with PBST. The sections were incubated with DAPI for 20 min, washed twice with PBST, and mounted on slides with Vectashield mounting medium (Vector Labs, Burlingame, CA). Images were obtained in a Zeiss LSM 800 confocal microscope, and Z-stack images were obtained with FIJI software.
Neurological evaluation
Animals were evaluated with a battery of neurological tests for body posture and movement control at 1, 7, and 14 days after stroke. The severity of functional deficits was scored by assessing ten items described in Table 1. Two trained observers blinded to the experimental treatment performed all evaluations independently.
LC-MS Analysis.
A total of 17 µg of protein per condition were loaded and separated in a single 12% SDS-PAGE lane; then, the gel was stained using a Silver Staining kit (Life Technologies). Each lane was cut into ten fractions, which were enzymatically digested as previously described 33. The generated tryptic peptides were concentrated to an approximated volume of 15 µL, of which 4.5 µL were loaded and separated on an HSS T3 C18 Column (Waters, Milford, MA); 75 µm X 150 mm, 100 A° pore size, 1.8 µm particle size; using a UPLC ACQUITY M-Class (Waters, Milford, MA). The mobile phase A consisted of 0.1% formic acid (FA) in water, and the mobile phase B was 0.1% FA in acetonitrile with the following gradient: 0 min 7% B, 30.37 min 40% B, 32.03–35.34 min 85% B, 37–47 min 7% B at a flow of 400 nl/min at 45°C (column temperature). The spectra data were acquired in a mass spectrometer with electrospray ionization and ion mobility separation Synapt G2-Si (Waters, Milford, MA) using a data-independent acquisition approach with a high-definition MSE mode. The ionization was set with the following parameters: 2.75 kV in the sampler capillary, 30 V in the sampling cone, 30 V in the source offset, 70°C for the source temperature, 0.5 bar for the nanoflow gas, and 150 L/h for the purge gas flow. Two chromatograms were acquired (low and high-energy chromatograms) in a positive mode range of 50 − 2000 m/z with a scan time of 500 ms. No collision energy was applied to obtain the low-energy chromatogram, while for the high-energy chromatograms, the precursor ions were fragmented in the transfer using a collision energy ramp from 19 to 55 eV. All conditions were injected in triplicate, and the Synapt G2-Si was calibrated with [Glu1]-fibrinopeptide, [M + 2H]2 + = 785.84261 at 1.5 ppm.
For the analysis, 60 *.raw files containing MS and MS/MS spectra from each fraction were analyzed and quantified label-free with Progenesis QI for Proteomics v4.1(Nonlinear Dynamics, Milford, MA) using a target decoy strategy against the Mus musculus *.fasta database (obtained from Uniprot, UP000000589, 55471 protein sequences), which was concatenated with the same *.fasta file in the reverse sense. The parameters used for protein identification were: trypsin as the cutting enzyme and one missed cleavage allowed; carbamidomethyl (C) as a fixed modification and oxidation (M), amidation (C-terminal), deamidation (Q, N) or phosphorylation (S, T, Y) as variable modifications; peptide and fragment tolerance were set to automatic, minimum fragment ion matches per peptide: 2, minimum fragment ion matches per protein: 5, minimum peptide matches per protein: 1, and false discovery rate less than 4%. The average intensity of the three most abundant peptides per protein (Top3) was used for label-free quantitation according to a previously described method 34. The Top3 values of a specific protein were summarized if a protein was detected in more than one piece of SDS-PAGE.
All proteins considered differentially expressed (DEPs) in this work displayed at least a fold change (FC) of ± 1 (expressed as log2), calculated on the Top3 signal of each characterized protein in hypoxia over normoxia. All DEPs have a p-value ≤ 0.05, at least two total peptides, including at least one unique peptide. Finally, all DEPs reported in this work were repeated in 3/3 injections.
The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE35 partner repository with the dataset identifier PXD033915.
Statistical analysis
GraphPad Prism 9 was used to analyze the data, which were considered significant at a p < 0.05. The actual statistical test used for each data set is indicated in the Results section and the Figure legends.