Aβ1−42 oligomerization
Aβ1−42 oligomeric peptide (Sigma-Aldrich Company, Germany, Catalog Number A9810) was dissolved with anhydrous dimethyl sulfoxide (DMSO) to the concentration 500 µmol/L as previous described[42]. And then the stock solution (100 µmol/L) was make phosphate-buffered saline (PBS) and stored at − 20 °C before use.
Animals And Subretinal Injection
C57bl/6J mice (Slaccas Laboratory Animal, Shanghai, China) were obtained at room temperature under a 12-hour light-dark cycle. All the animal studies were conducted according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The protocol was approved by the Committee on the Ethics of Animal Experiments of the tenth people’s hospital affiliated Tongji University (Permit Number: SHDSYY-2020-2938). At least three individuals were performed for each experiment.
The subretinal injection was performed according to the previous studies[18]. Twelve-week‐old C57bl/6J mice were anesthetized by an intraperitoneal (IP) injection of 4% chloral hydrate, and the pupils were dilated with 1% tropicamide (Alcon, USA). One eye was injected with 2 µL Aβ1−42 solution (100 µmol/L), and the other eye was injected with 2 µL PBS (vehicle). Briefly, a 30-gauge needle puncture the sclera 2-mm behind the limbus to make a tunnel. Then 2 µL Aβ1−42 solution or PBS was subretinal injected using a 33-gauge blunt needle (Hamilton Company, Reno, NV, USA).
Electroretinography (ERG)
RETIscan System (Roland Consult, Brandenburg, Germany) was used for scotopic ERG with signal stimulation, amplification and transportation. The protocol was followed as previous described [43], the ERG was carried out on day 1, day 3, and day 7 post-injection. Briefly, the mice were dark-adapted over 16 hours before performing ERG, mice were general anesthetized with an IP of 4% chloral hydrate under dim red illumination. Pupils of mice were dilated with 1% tropicamide for at least 20 minutes. After 0.5% Proparacaine hydrochloride (Alcon) applied for topical anesthesia of the cornea, contact lens electrodes with Gold wire loops were fixed on the surface of two corneas and the ground electrode was fixed in the tail, the parameters of scotopic ERG were measured. The amplitude of both a-wave and b-wave were recorded and analyzed using built-in software of ERG system.
TUNEL Assay
Apoptosis was detected with the kit of terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) according to the manufacturer instruction (YEASEN, China). Apoptotic cells were analyzed using Image J software.
Immunofluorescence
The cryosections of the retina and the primary microglia cells were permeabilized, blocked and incubated the primary antibody of Iba-1 (1:500, Wako) overnight at 4 °C. After washing thrice with PBS, the cryosections were incubated with Goat anti-Rabbit IgG conjugated to Alexa-568 (1:200, Invitrogen) for 1 hour at room temperature. After extensive wash, then the sections were counterstained with DAPI.
For the retinal whole-mount preparations, mice eyeballs were enucleated and fixed with 4% paraformaldehyde (PFA) for 2 hours, and then washed with PBS for three times. The retinas were isolated under dissecting microscope and were cut into four parts. Following the permeabilization and blocking step, the flat-mounts were incubated with the primary antibody of Iba-1 (1:500, Wako) overnight at 4 °C. After washing with PBS, the retina flat-mounts were incubated with the secondary antibody labeled with Alexa-568 (1:200, Invitrogen) for 2 hours and counterstained with DAPI.
The immunofluorescence of the cryosections, retinal flat-mounts and the primary cells were examined with NIKON A1 + confocal microscope (NIKON, Japan). The pictures were analyzed using ImageJ.
Protein Extraction And Western Blot Analysis
The mice retina, primary microglial cells and 661W cells were lysed by radio-immunoprecipitation assay (RIPA) buffer containing proteinase inhibitors (Beyotime, Shanghai, China). After denaturation, 30 µg of each sample was separated by SDS-PAGE (10–15% gradient) gel (Beyotime, Shanghai, China) and transferred to nitrocellulose membranes (Bio-Rad). The membranes were blocked by 5% skimmed milk in Tris-buffered saline with Tween-20 (TBST) (Bright Dairy & Food Co., Ltd., Shanghai, China) for 30 minutes at room temperature. Then the membranes were incubated with the primary antibodies against TSPO (1:1,000, abcam, No. ab92291), CD86 (1:500, abcam, No. ab112490), COX2 (1:1,000, abcam, No. ab15191), IL-1β (1:1,000, abcam, No. ab9722), caspase 3 (1:1,000, cell signaling Technology, No.9662 ), cleaved caspase 3 (1:1,000, cell signaling Technology, No.9661 ), Phospho-p38 MAPK (1:1,000, Cell Signaling Technology, No.4511), p38 MAPK (1:1,000, Cell Signaling Technology, No.8690) or β-actin (1:5,000, abcam) overnight at 4 °C. After washed thrice with TBST, the corresponding secondary antibodies were incubated at room temperature for 1 hour, and then washed thoroughly with TBST. The membranes were imaged with Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE). The optical density of each band was quantified by using Quantity One software (Bio-Rad), and was normalized with β-actin.
Primary Microglial Cell And 661W Cell Culture
Mouse primary microglial cells were isolated from the brains of C57bl/6J mice at postnatal day 4 or day 5 according to previously described[44]. After detaching from brain tissues, microglial cells were maintained in 75 cm2 flasks containing DMEM supplemented with 10% fetal bovine serum (FBS, Gibco), 10 ng/mL GM-CSF, 50 U/mL penicillin and 50 mg/mL streptomycin in a 37◦C incubator. The microglial cells culture medium was replaced every 3 days and was identified with Iba-1immunostaining (1:500, WAKO). The microglia were plated at 5 × 105 cells/mL in twelve-well plate for further study.
661W, a murine photoreceptor-like cell line, was cultured in DMEM supplemented with 10% FBS, 1% penicillin and streptomycin (Invitrogen) under 5% CO2 in the incubator at 37 °C.
Cell Viability Assay
Cell counting kit-8 (CCK-8) assay (MCE, USA) was used to detect microglial cells viability according to manufacturer's instruction. Microglial cells were seeded in 96-well plates with a density of 1.0 × 104 cells per well. To determine the optimal dose of Aβ1 − 42 on microglia, Aβ1 − 42 with the final concentration of 0, 0.5, 1, 2, 4, 8,10 µmol/L was added into each well and cultured at 37 °C for 24 hours. After that, 10 µL CCK-8 reagent was added to each well. The microglial cells were incubated for 2 hours, and the absorbance value of each well was measured at 450 nm. According to the standard curve, the corresponding cell viability was calculated.
Microglial Conditioned Medium (MCM)
Mouse primary microglial cells were cultured with 2 µmol/L Aβ1 − 42 for 24 hours, then the supernatant was collected as MCM, centrifuged to remove cellular debris (5 minutes, 3,000 g), MCM was applied to 661W medium, then 661W were plated at 3 × 105 cells/mL in twelve-well plate for 24 hours for Western blot detection. The supernatant of primary microglial cells without adding to Aβ1 − 42 was served as control medium (CM).
Protein Kinase Inhibitor For P38 MAPK
The protein kinase inhibitor for p38 MAPK (BIRB 796) was obtained from Selleck Co. (USA), dissolved in DMSO and diluted with DMEM to a concentration of 10 µmol/L. Microglial cells were pretreated with inhibitor (10 µmol/L BIRB 796) 1 hour before with 2 µmol/L Aβ1-42 treatment in medium.
Reverse-transcription Quantitative Polymerase Chain Reaction (RT-qPCR)
Total RNA of primary microglia was isolated with RNAiso reagent (Yeasen Biotech, Shanghai, China) according to the manufacturer’s instruction. Reverse transcribed using a PrimeScript® RT Reagent Kit (Yeasen Biotech, Shanghai, China). Quantitative PCR was performed with a CFX96 Real-Time PCR System (Bio-Rad, Hercules, USA) with the primers information provided in Table 1. Relative changes in gene expression were calculated using the 2−ΔΔCt method.
Table 1
༎The primer information used in this study.
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Product size (bp) |
IL-1β | TGCCACCTTTTGACAGTGATG | TGATGTGCTGCTGCGAGATT | 138 |
COX-2 | CATCCCCTTCCTGCGAAGTT | CATGGGAGTTGGGCAGTCAT | 178 |
TNF-α | TGTGCTCAGAGCTTTCAACAA | CTTGATGGTGGTGCATGAGA | 88 |
iNOS | CCCTTCAATGGTTGGTACATGG | ACATTGATCTCCGTGACAGCC | 158 |
β-actin | AGGCGACAGCAGTTGGTTGGA | TTGGGAGGGTGAGGGACTTCCT | 166 |
Statistical analysis
Statistical analyses were performed with OriginPro 2018 Software. All experiments were repeated at least three times. Data were expressed as mean ± SE. Differences between groups were compared with Student t-test and one-way ANOVA, Bonferroni’s test was analyzed for post hoc comparisons. A P-value < 0.05 was considered to be statistically significant.