Strains, growth medium, and culture conditions
Synechococcus elongatus PCC 7942 and Chlorella sorokiniana UTEX 1230 were maintained and cultured using freshly prepared solid or liquid BG11 medium (17.6 mM NaNO3; 0.23 mM K2HPO4; 0.3 mM MgSO4; 0.24 mM CaCl2×2H2O; 0.031 mM C6H8O7×H2O; 0.021 mM (NH4)5[Fe(C6H4O7)2]; 0.0027 mM Na2EDTA2H2O; 0.19 NaCO2; 1 X BG-11 trace metals solution). Solid media were prepared using 1 % (w/v) Bacto-agar (Difco, Franklin Lakes, NJ) or agarose Nara Biotec®. Liquid cultures were maintained in an orbital shaker (MRCLOM-150DIG/500DIG) at 110 rpm. All cultures were maintained at 34 ± 1°C and 100 mmole×m-2×s-1 of continuous fluorescent white light.
Microalgae consortiums Comp 1 and Comp 2 were isolated from a pond water (coordinate 20°43'15.6"N 101°19'51.1"W) close to the microalgae pilot plant. During the isolation process, the water samples collected were immediately subjected to the blooming process by incubating the samples in a growth chamber at 34 ± 1°C and an irradiance of 100 mmole×m-2×s-1 of continuous fluorescent white light. BG-11 was used as the enrichment and isolation medium [56]. Algae were isolated by serial dilution technique. One milliliter of the culture from tubes showing algal growth in highest dilution tubes was spread onto BG-11 agar plates which were incubated for 2 weeks. Afterwards, isolated single colonies were picked up and maintained on BG-11 agar plates. Microalgal strains and consortia, were screened for their growth response in BG-11 medium.
Plasmid construction and genetic transformation
The ptxD encoding gene from P. stutzeri WM88 (AF061070, http://www.ncbi.nlm.nih.gov/nuccore/AF061070) was codon optimized to the nuclear codon usage of S. elongatus according to the OptimumGeneTM-Codon optimization Tool (GenScript, Piscataway, NJ) and placed under control of the psbA1 constitutive promoter of the psyn_6 vector (Life Technologies Corporation, Carlsbad, CA). Psyn_6 harbors a spectinomycin resistance cassette for the selection of E. coli and S. elongatus and has NS1 (neutral site 1) homologous recombination sites for the integration of the TDNA into the S. elongatus genome. NS1a and NS1b (neutral site 1) sites are also present on S. elongatus genome to guide double homologous recombination of DNA contained between the neutral sites in the vector [57]. The ptxD gene was synthesized with the required restriction sites and cloned into NdeI and NsiI sites to create the plasmid psyn6_PTXDopt. The resulting plasmid were then subjected to restriction digestion analysis using EcoRI and BglII and sequencing analysis to corroborate the correct psbA1::ptxD gene construct.
The wild type strain S. elongatus PCC7942 (SeWT) used in this study was then transformed via natural for genomic integration of exogenous genes according to the user’s guide of GeneArt ® Synechococcus Engineering kit (Life Technologies Corporation). Briefly, 15 mL of culture from middle logarithmic phase at 8.7 x 108 cells/mL were collected by centrifugation and resuspended in 300 μL BG-11 without any source of phosphate in the medium. Plasmid DNA (200 ng) was added to the cell suspension and incubated in dark for 16 h at 34 °C and 110 rpm. Transformants were selected using BG-11 agar plates supplemented with 100 μg/mL spectinomycin as a selective agent. Screening of transformants for growth on Phi medium as the sole P source was carried out using multiwell culture plates and 50 mL glass flasks. Selected transgenic lines were always maintained in Phi containing medium. Selected transgenic lines were always maintained in Phi containing medium.
PCR colony analysis
Colonies grown onto BG-11 agar plates under conditions mentioned above were picked out and resuspended in 5-10 μL DMSO and subjected to heat at 95 ˚C for 5 min. One μL of the resultant suspension was used as a template for PCR. SeptxD primers, Fw 5’- CTCTGCTGGTCAATCCGTGT-3’ and Rv 5’-GCCTTGGGCAGGCGATTA-3´’ were used to amplify a 500 base pairs (bp) fragment using Taq DNA Polymerase Recombinant (Life Technologies). The thermocycler was programmed as follows: 94 °C for 3 min, denaturation (94 °C for 30 s), annealing (64 °C for 30 s) and extension (72 °C 1 m) for 34 cycles, then a final extension at 72 °C for 7 min. The PCR products were examined on a 1 % agarose gel using SYBR-Safe DNA gel stain (Life Technologies).
Real time quantitative PCR
Total RNA was isolated using the PureZOLTM RNA isolation Reagent (Bio-Rad, Hercules, CA) following the manufacturer’s instructions. The purified total RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA), and its quality and integrity were corroborated by agarose gel electrophoresis (1.2 %). Subsequently, 10 mg of RNA was treated with DNaseI (New England Biolabs, Ipswich, MA) to eliminate any contaminating genomic DNA. Gene-specific primer to amplify ptxD (SeptxD primers), SerpoD (Fw 5’- AGATGGTGCAGTCGAACCTG-3, Rv 5’-GAGTGGCGATCTCTTCCTCG-3’’), and SernpB (Fw 5’- AAAAGACCAGACTTGCTGGGT -3, Rv 5’- CGAAGACAGAGGGCAGTTATC-3’) genes were designed using the NCBI/ Primer-BLAST tool [58]. SerpoDA and SernpB were used as housekeeping genes for cDNA content normalization [59]. cDNAs were synthesized by adding 2μM of gene-specific reverse primers and 500 mM of dNTPs mix to 500 ng of total RNA. This mixture was incubated at 65°C for five minutes and briefly chilled on ice. First Strand Buffer (Invitrogen), 20 mM of dithiothreitol (DTT) and 200 units of Superscript III (Invitrogen) were added to the prior mixture to a total volume of 20 μL and incubated at 55°C for 1 h following manufacturer’s instructions. Inactivation of the reverse transcriptase was done by incubating the mixture at 70°C for 15 min and the cDNA solution was stored at -20°C. PCR (Polymerase Chain Reaction) was performed using the SensiFAST SYBR No-ROX Kit (BIOLINE) in MIC qPCR Magnetic Induction Cycler (BIOLINE) system. Reaction mixtures contained 1μL cDNA, 400 nM of each primer and SensiFAST SYBR® No-ROX Mix, in a total volume of 10 mL. Reaction mixtures were incubated for two minutes at 95°C, followed by 40 amplification cycles of 5 s at 94°C, 10 s at 60°C and 20 s at 72°C. Results were analyzed using the MIC qPCR Cycler on-board software (BIOLINE). The qPCR was conducted with at least three experimental replicates for each biological sample.
PTXD activity determination
The enzymatic activity of PTXD was measured from total extracts of S. elongatus. 0.2 g of fresh biomass was weighed, washed twice with 1 mL of 50 % acetone to extract the chlorophyll, and then centrifuged at 4000 rpm for 5 min at 4 °C. The pellet was resuspended in 1 mL of lysis buffer (50 mM MOPS pH 7.25, 150 mM NaCl, 5 % glycerol, 5 mM β-mercaptoethanol, 1 mM PMSF) and sonicated with six short bursts of 30 s followed by intervals of 30 s for cooling on ice, at an amplitude of 40 %. To lower cell debris, samples were centrifuged at 20,000 rpm for 30 min at 4 ° C. Total protein concentration of the supernatant was determined by Bradford method (Bradford, 1976) using the Quick Start™ Bradford dye (BioRad), following the supplier’s specifications. PTXD activity was determined by measuring the fluorescence emitted by NADH. The reaction mixture was prepared at a final concentration of 50 mM MOPS (pH 7.25), 0.5 mM NAD+, 1 mM phosphite, and 50 mg total protein (protein extract), in a final volume of 250 mL. The fluorescence intensity of NADH was measured after one hour of incubation at 30 °C in a fluorescence reader (Fluoroskan Ascent™ Microplate Fluorometer), at an excitation and emission wavelength of 340 and 460 nm, respectively.
Growth of S. elongatus PCC7942 and transgenic lines on phosphite media
For the experiments to study the capacity of S. elongatus PCC7942 (SeWT) and the transgenic lines to use Phi, the sources of P on the conventional BG-11 media, potassium phosphate dibasic (K2HPO4 0.2 mM) were substituted by potassium phosphite monobasic (KH2PO3, Wanjie International CAS No. 13977-65-6) at different concentrations as noted for each experiment, using standard BG-11 and BG-11 devoid of P media as controls. SeWT was cultivated in 50 mL glass flask with 30 mL media, inoculated at 1 % (v/v), and incubated at 34 °C, 110 rpm and 100 mmole×m-2×s-1 of continuous fluorescent white light. Growth was estimated by measuring cell density using a Neubauer chamber. All the experiments were conducted in triplicate during a period of 8 days after inoculation.
Growth competition assays
Chlorella sorokiniana UTEX 1230 (CsWT) and two microalgal consortium (Comp 1 and Comp 2) isolated from a water pond (coordinate 20°43'15.6"N 101°19'51.1"W) close to cultivation plant pilot were used as the competitors for in vitro assays. For the competition experiment with CsWT, proportions 1:1, 1:4, and 4:1 of inoculums C. sorokiniana: SeptxD-2 were used, whereas for experiments with Comp 1 and Comp 2 proportion 1:1 (SeptxD-2:Comp) was implemented. The competition cultures were growth in BG-11 media supplemented with 1.8 mM Phi or 0.2 mM Pi as the phosphorus (P) source. Monocultures of both microalgae were used as controls. Experiments were carried out using 50 mL glass flasks with 30 mL of media, under culture conditions described above. Each treatment was performed in triplicated. The algal growth was estimated by cell counting with a Neubauer chamber. For experiments under non-sterile conditions, sterilization of materials and growth media were avoided to allow microorganisms to invade the cultures. Cultures were observed and photographed using a Zeiss Axio Lab.A1 microscope.
Scale-up of liquid cultures, outdoor cultivation and biosafety regulation
Scale-up of liquid cultures for inoculum preparation
For inoculum preparation, 25 mL cultures of the strains were started by scraping a portion of the culture from a plate and re-suspending in 5 mL of media before added to the 50 mL flask. 20 mL cultures were then passed directly to 700 mL cultures in 1 L glass bottles or Erlenmeyer flasks and then to 7 L of media in 10 L home-designed cylindrical bioreactors. 20 mL cultures were grown on an orbital shaker at 110 rpm, 34 ± 1 °C, 100 mmole×m-2×s-1 of continuous fluorescent white light, under ambient atmosphere, whereas 700 mL cultures were bubbled with air at a flow rate of 2 L/min. Autoclaved BG-11 media were used for cultivation in Petri dishes, in 50 mL and 1 L containers, whereas non-sterile media were used for the rest of the process. pH was adjusted to 7 in all freshly prepared media. For experiments under non-sterile conditions, sterilization of materials and growth media were avoided to allow microorganisms to invade the cultures.
Cultivation in 10 L cylindrical bioreactors
After growth, 700 mL cultures were used to inoculate 7 L of media in 10 L home-made cylindrical bioreactors and grow at 100 mmole×m-2×s-1 of continuous fluorescent white light, and using charcoal-filtered dechlorinated municipal tap water. Cylindrical bioreactors, 45 cm height, 20 cm internal diameter and 7 L working volume, were constructed with acrylic using a 12 mm thick sheet PLASTICRYL purchased from Brunssen de Occidente (item #0171-0010-012) from Guadalajara, Jalisco, Mexico. Air was supplied and maintained to each culture at a flow rate of approximately 10 L/min by manually adjusting tubing connections to a small pump. We did not detect any observable growth variations for any culture in reference to air flow-rate.
Cell counting and pH was monitored every day during the timeframe of the experiment. As we detected no significant pH variations throughout the experiments, pH was not subsequently adjusted. Samples were withdrawn trough the vent holes in the cap using glass pipettes. During the continuous cultivation, only 6.5 mL were removed and the bioreactors refilled with BG-11 media. To avoid cross contamination between the transgenic lines, tubing and accessories were washed using 1.5 mg/L calcium hypochlorite and flushed with water.
Cultivation in 100 L cylindrical bioreactors
Outdoor experiments were performed in StelaGenomics Inc facility located in Irapuato Guanajuato Mexico (20°42'56.2"N 101°20'16.4"W). Cylindrical bioreactors, 1.45 m height, 35 cm internal diameter and 100 L working volume (110 L total volume), were constructed with acrylic using a 12 mm thick sheet purchased from Brunssen de Occidente from Guadalajara, Jalisco. Each cylindrical bioreactor was installed in a robust metal structure and suspended about 1.95 m above soil level. The air was supplied and maintained to each column at a flow rate of approximately 20 L/min by manually adjusting a blower; an internal removable stainless-steel diffuser device was installed in each column. Separate PVC lines were installed in each cylindrical bioreactor to allow culture transfer to 1,000 L raceway ponds. CFU from contaminating bacteria was estimated by serial dilutions (1:10, 1:100 and 1:1000) of the sample and plating onto Petri dishes with LB (Luria Bertani) medium. The plates were then incubated at 37 °C for 48 h. CFU was manually counted and data analyzed.
Cultivation in 1,000 L raceway
Following growth in cylindrical bioreactors, the culture was used to inoculate 1,000 L raceway ponds. For the raceway ponds, we constructed a carbon steel structure with an oval shape (1.5 m width, 3.5 m in length, 60 cm depth), which were covered with a HDPE (high-density polyethylene) geomembrane. Raceways were installed 25 cm above soil level and operated at a depth of 25 cm. A stainless-steel propeller device was installed to recirculate the culture, which was operated at about 10 cm depth and rotated at the speed of 15 rpm.
Optical density (OD750), pH, temperature of the media, and solar irradiance were recorded every day 9 am and 6 pm during the timeframe of the experiments. As we detected no significant pH variations throughout the experiments, pH was not subsequently adjusted. Biomass concentration was determined after 7 days of cultivation.
For experiments outdoor, non-sterile BG-11 media were prepared using industrial grade reagents: NaNO3 (ISAAQUIM, ERI52LO0619), MgSO4·7H2O (ISAAQUIM, S114773046), CaCl2·2H2O (ISAAQUIM, CC51110120), KHPO4 (ISAAQUIM, 011771924431), (HOOCCH₂)₂C(OH)COOH, (NH4)5[Fe(C6H4O7)2] (ISAAQUIM, 82239488QO), Na2CO3 (ISAAQUIM, 090120).
Environmental conditions during the timeframe of the experiments can be seen directly at https://weatherspark.com/y/4553/Average-Weather-in-Irapuato-Mexico-Year-Round.
Biosafety regulation
Based on the provisions of the Mexico´s Biosafety Law of Genetically Modified Organisms, on August 15, 2014, StelaGenomics submitted a notice for the Confined Use of Genetically Modified Organisms (application no. 09/J7-0081/08/14) to the Secretariat of Environment of Mexico (SEMARNAT), whereby the company stated that the activities with genetically modified organisms would be the culture of microalgae, cyanobacteria and other microorganisms, in cylindrical reactors and open raceways ponds located in the facilities of StelaGenomics, applying the appropriate biosafety measures. On March 22, 2016, SEMARNAT delivered a favorable opinion, through the document SGPA/DGIRA/DG/1639, in which the aforementioned activities were approved, as long as the biosafety measures stated in the notice are applied. One of the S. elongatus strains generated under this application was selected for outdoor cultivation. Some of the biosafety measures implemented are: access to the facility to microalgae is restricted by a perimeter fence and there is personal and video surveillance 24 hours/day; bioreactors and raceways ponds are installed on a cement platform covered with an industrial polymer (or with a high-density polyethylene impermeable geomembrane) to retain and control any potential leak and to avoid leaks to the soil; the core facility is surrounded by a 30 cm perimeter barrier to prevent the escape of biological material to the environment in case of accidental spill caused by flooding or excessive rain; this platform has PVC connections to discharge potential spilled liquids into a 10,000 L plastic container (Rotoplast) installed belowground, where the liquids are chlorinated and treated with an UV lamp, before recycling into the process; 7 L the cylindrical rectors are covered acrylic caps; raceways ponds are covered with an anti-bird netting and anti-aphid mesh, preventing the access of any type of birds and insects that could spread microalgae in the surrounding area; after harvesting to determine production of biomass, waste water is chlorinated, UV treated and recirculated into the system.
Dispersal experiments
To examine the potential dispersion of the transgenic lines from the raceway ponds to the environment, we implemented a kind of tramps surrounding the pilot plant. Tramps consisted in 1,200 L plastic containers placed on the north, south and east directions from the source cultivated ponds filled with 500 L water and supplemented with BG-11 medium (Supplementary Figure 12, Additional File 1). In east direction, three traps were placed at 3, 6, and 28 m from the raceway facility. In the north and south, only one tank was placed at 1.5 m from the raceway. 50 mL samples were collected from containment tanks, tree times per week and preserved at -20°C for PCR and RT-PCR analysis. Samples were melted, homogenized, and 1 mL was retired from the original sample and placed in 1.5 mL tubes. Samples were centrifuged at 4200 rpm for 20 min; the pellet was re-suspended in 0.5 mL DMSO and subjected to heat at 95 ˚C for 5 min. 2 mL of the resultant suspension was used as a template for the PCR and RT-PCR. SeptxD primers, Fw-5’CTCTGCTGGTCAATCCGTGT-3’ and Rv 5’-GCCTTGGGCAGGCGATTA-3´’ were used to amplify a fragment of 304 bp. The thermocycler was programmed as follows: 94 °C for 3 min, denaturation (94 °C for 30 s), annealing (64 °C for 30 s) and extension (72 °C 1 m) for 34 cycles, then a final extension at 72 °C for 7 min, with Taq DNA Polymerase Recombinant (Life Technologies). The PCR products were examined on a 1 % agarose gel using SYBR-Safe DNA gel stain (Life Technologies).
Statistical analysis
Results are expressed as mean standard deviation (± SD) of three replicates. Statistical analysis was performed using the program R 3.5.2. Date collected from the different experiments were subjected to paired Student t-test, with Bonferroni correction or one sample Student t-test. P values < 0.05 were considered significant. Single stars denote P < 0.05, double stars P < 0.01, triple stars P < 0.0001.