Cell culture and irradiation
Human 293T, non-small-cell lung cancer (NSCLC) cell lines H460 and A549 were purchased from the American Type Culture Collection. 293T cells were cultured in DMEM, H460 and A549 cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) as well as 100 units/ml penicillin and 100 µg/ml streptomycin (both from Thermo Fisher Scientific) at 37℃ in humidified incubator with 5% CO2. Cells or mice were irradiated with a cabinet X-ray generator (Faxitron) operated at 180 kVp and 10 mA with a dose rate of 3.0 Gy/min for the time required to apply a prescribed dose at room temperature.
Lentivirus packaging and transduction
The pLEX lentiviral system (Open Biosystems) was used to transduce genes into target cells. The firefly luciferase (Fluc) and green fluorescent protein (GFP) fusion gene was kindly provided by Prof. Chuan-Yuan Li. Fluc and GFP labeled cells (named as Fluc cells) were acquired via lentivirous infection as previous described [10], then cells were cultured in RPMI 1640 supplemented with 10% FBS and 1 µg/ml puromycin for 2 weeks selection.
Establishment of caspase-3 knockout (Casp3 KO) cells
Casp3 KO A549 and H460 cells were established by use of CRISPR/Cas9 genome editing system. The Casp3 KO lentivirus-based CRISPR plasmid [13, 19] (designated as the Casp3 KO plasmid) was also obtained from Prof. Chuan-Yuan Li. The single-guided RNA (sgRNA) sequence used to disrupt the CASP3 gene is 5’-TAGTTAATAAAGGTATCCA-3’. This plasmid was packaged according to an established protocol [20]. A549 and H460 cells were seeded into a 6-well plate at a density of 5 × 105, then cells were infected with Casp3 KO plasmid-encoding lentivirus for 24 h and cultured in RPMI 1640 medium supplemented with 10% FBS, 48 h after infection, cells were selected in culture medium containing 1 µg/ml puromycin for 2 weeks. Surviving cells were then dissociated by trypsinization (Gibco) to obtain single cells and plated into 96-well plate with 1 cell per well. Single cells derived clones were selected and western blot analysis was used to identify the status of genome editing after an expansion period. Those clones with no detectable caspase-3 signal were chosen for further study.
Cell clonogenic formation assay
Cells were counted and seeded into 6-well plates. Next, cells were exposed to different radiation doses (0, 2, 4, 6 and 8 Gy with 100 to 10000 cells per well respectively). After 10–14 days, cells were fixed with 4% paraformaldehyde (Sangon Biotech) and stained with crystal violet (Beyotime). The colonies containing more than 50 cells were scored, experiments were repeated in triplicate. The surviving fraction was calculated as previous described [21].
Flow cytometry
Cells were treated with 8 Gy radiation for 72 h, then stained with FITC-Annexin V and propidium iodide (PI) using an FITC Annexin V Apoptosis Detection Kit (BD Bioscience) following the manufacturer's instructions. Apoptosis was measured using a BD Accuri C6 flow cytometer.
Western blotting
Whole cell lysates were prepared in RIPA buffer with protease and phosphatase inhibitors (Roche) at 4℃. Protein concentrations were determined by using BCA protein assay kit (Thermo Scientific). Western blotting analysis was performed as previously described [22]. Primary antibodies were against β-tublin, GAPDH, caspase-3, Cleaved caspase-3, Cox-2, ATM, patm-S1981, pchk2-T68, pp53-S15 (#2128, #5174, #9662, #9664, #12282, #2873, #5883, #2197, #9286, Cell Signaling Technology), p53, EndoG, Histone H3 (#ab1101, #ab9647, #ab1791, Abcam) and Chk2 (#A19543, ABclonal).
Tumor repopulation model and bioluminescence imaging
In our in vitro repopulation model, a large number (1-2.5 × 105) of irradiated cells (named as feeder cells) were cocultured with a small number (200 or 500) of non-irradiated Fluc cells (named as reporter cells). During coculture period, the culture medium was replaced with fresh 2% FBS RPMI 1640 every 2 days. After 6–10 days, growth of the Fluc cells was measured by bioluminescence imaging and D-Luciferin potassium (0.15 mg/ml; Synchem) was added to produce bioluminescence. IVIS Lumina Series III (PerkinElmer) was used to measure bioluminescence imaging.
Quantitative real-time PCR (Q-PCR)
Total RNA was extracted from cells with RNA-extracting reagent RNAiso Plus and reverse transcribed into cDNA with the PrimeScript™ RT Master Mix Kit. Q-PCR was performed with TB Green® Premix Ex Taq™ Kit (#9109, #RR036A, #RR420A, Takara) according to the manufacturer's protocol. The primer of Cox-2 was “GAAGTCCCTGAGCATCTACGG” (forward) and “CCTATCAGTATTAGCCTGCTTGTCT” (reverse). The primer of p53 was “ACCTATGGAAACTACTTCCTGAAA” (forward) and “CTGGCATTCTGGGAGCTTCA” (reverse). The primer of GAPDH was “CCGGGAAACTGTGGCGTGATGG” (forward) and “AGGTGGAGGAGTGGGTGTCGCTGTT” (reverse). GAPDH was used as a loading control. The Q-PCR procedure was performed under following conditions: 30 sec at 95 °C, followed by 40 cycles of 5 sec at 95 °C and 30 sec at 60 °C. The results were obtained at three independent experiments. Relative expression differences were calculated using 2−ΔΔCT method.
Transient transfection
For p53 overexpression, we transiently transfected the pcDNA3-p53 (WT) plasmid in to cells with Lipofectamine 2000 (Life Technologies), following the recommended protocol. The pcDNA3-p53 (WT) plasmid was synthesized by Shanghai HarO Biotech Co., Ltd. and the empty pcDNA3 plasmid (Invitrogen) was used as a control. Cells were incubated with Opti-MEM (Gibco) without FBS during transfections, and transfection medium was replaced with RPMI 1640 after 6 h.
PGE2 enzyme-linked immunosorbent assay (ELISA) assay
Cells were cultured in RPMI 1640 supplemented with 10% FBS and treated with 8 Gy radiation. Culture media was removed and replaced with fresh media with 2% FBS for 16 h before collection of supernatants at 48 h after radiation. PGE2 levels in the supernatants were measured by Prostaglandin E2 Express ELISA Kit (Cayman Chemical) according to the manufacturer’s protocol.
Reagent
Celecoxib was obtained from Selleck Chemicals.
Immunofluorescence staining
Cells were incubated with antibodies against γH2AX, caspase-3 (#80312, #9662, Cell Signaling Technology) or EndoG (#ab9647, Abcam) overnight at 4℃, then incubated with Alexa Fluor 488 or 594 secondary antibody (Proteintech). Nuclei were counterstained using DAPI reagent (Yeasen). Images were captured using a confocal laser scanning microscope (Leica Microsystems).
Luciferase reporter assay
The upstream 2 kb promoter segment of PTGS2 (Cox-2) containing the potential p53 binding site was cloned into GV238 (GeneChem) luciferase reporter vector (PTGS2-WT), and the mutated p53 binding site was also cloned into the same luciferase reporter vector (PTGS2-Mut). P53 overexpression (pcDNA3-p53) plasmid was co-transfected with PTGS2-WT plasmid or PTGS2-Mut plasmid or empty vector in 293T cells for 24 h. Luciferase activity was performed using the dual luciferase reporter assay system (Promega) and normalized to Renilla luciferase activity.
Xenograft tumor model
All animal protocols were approved by the Shanghai General Hospital Institutional Animal Care and Use Committee and also in accordance with the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes. Five-week-old BALB/c mice were housed in SPF facilities with free access to normal chow and water. Seven nude mice were injected subcutaneously with wild-type or Casp3 KO H460 cells (5 × 106 cells) into the left or right armpit regions, respectively. Tumor volume (volume = length × width2/2) was determined by calipers every 2 to 3 days. When the mean tumor volumes reached about 2000 mm3, the mice were randomly divided into two groups: 0 Gy radiation (n = 3) and 8 Gy radiation (n = 4). 48 hours after radiation treatment, all experimental mice were sacrificed and tumor sections were collected for further pathologic examination.
Hematoxylin and eosin (H&E) and immunohistochemistry (IHC) staining
H&E and IHC staining were performed as previously described [23, 24]. The primary antibodies against caspase-3, Cleaved caspase-3, Cox-2, ATM, patm-S1981, pchk2-T68, pp53-S15 (#9662, #9664, #12282, #2873, #5883, #2197, #9286, Cell Signaling Technology), p53 (#ab1101, Abcam), Chk2 (#A19543, ABclonal) were used during the process. Then, the sections were incubated with EnVision™ Ⅲ Detection System (GK500705; Gene Tech), counterstained with hematoxylin and visualized using a light microscopy from Leica.
Statistical analysis
All data were expressed as mean ± standard error (SE). Statistical analysis was performed using unpaired Student’s t test or one-way ANOVA with SPSS 18.0. Statistical significance was determined as P < 0.05.