Production of Spp24
Recombinant bovine Spp24 was produced in a bacterial expression vector as described in detail previously (9). The expression protein is engineered in such a manner as to place a (His)6-Met at the amino terminus of the recombinant form of the mature protein (lacking the leader sequence) in order to provide for stability and to allow purification of the protein by means of IMAC (immobilized metal affinity chromatography).
Cell culture
The highly malignant 143B and moderately malignant MG63 cells were used in this study, both were obtained from ATCC (Manassas, VA). Cells were grown in minimum essential medium (MEM) and Dulbecco's minimum essential medium (DMEM) respectively, supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 mg/mL) in a humidified atmosphere containing 5% CO2 at 37°C. Media were changed every 3 days. Cells were passaged when cultures reached 80-90% confluence.
MTT assay
To investigate the effects of BMP-2 and Spp24 on cell growth, 143B or MG63 cells were seeded into 96-well microplates at 2×103 cells per well. Cells were cultured for 24 hours to achieve attachment, starved for 12 hours with 1% FBS medium, then treated with a different combination of BMP-2 or Spp24 (Control group: without BMP-2 or Spp24; BMP-2 group: 50 ng/mL BMP-2; Spp24 group: 50 μg/mL Spp24; BMP-2+ Spp24 group: 50 ng/mL BMP-2 + 50 μg/mL Spp24) for 24 h. Cell growth was evaluated using a 3-(4, 5-dimethyl thiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay according to the manufacturer’s instructions (ATCC Manassas, VA). Absorbances were read at 570 nm with a reference wavelength of 700 nm.
Wound-healing assay
143B and MG63 cells were seeded in 12-well plates and incubated for 24 h until 90% confluence was achieved, then starved overnight with 0.5% FBS medium. After changing back to normal culture media, a sterile 200μL pipette tip was used to scratch wounds across the monolayer of cells and the wells were gently washed twice with phosphate-buffered saline (PBS) to remove the detached cells. 143B and MG63 cells were cultured with 2% FBS to eliminate the influence of cell proliferation. Cells were treated with BMP-2, Spp24, and BMP-2 and Spp24 as previously described. The wounds were photographed at each time point using an inverted microscope (Leica, Wetzlar, Germany). Image J software (National Institutes of Health; http://rsb.info.nih.gov/ij/) was used to quantify the migration rate by measuring the distance between the wound edges. All experiments were repeated in triplicates.
Matrigel invasion assay
Transwell in vitro invasion 24-well chambers (Corning, USA) were used following the manufacturer’s instruction. The membrane of each well was precoated with 500μL BD Matrigel (BD Biosciences, Bedford, MA). 2.5×104 143B or MG63 cells in 200μL serum-free medium were placed into the upper chamber, BMP-2 or Spp24 was added into the upper chamber as previously described. 500μL of medium containing 10% FBS was placed into the lower compartment. The transwell chambers were incubated for 24 h at 37°C in 95% air with 5% CO2. The membranes were fixed with methanol and cell penetration through the membrane was detected using crystal violet staining. Cell penetration was quantified by counting the numbers of cells in five microscopic fields (at x200 magnification) per filter. The studies were conducted in triplicate.
Cell-cycle and apoptosis analysis by flow cytometry (FCM)
143B cells were seeded into 6-well plates at a density of 8×104 cells/well and cultured overnight. When a confluence of 70-80% was reached, wells were washed with PBS and both cell lines were exposed to culture media with BMP-2 (100 ng/mL), Spp24 (20 μg/mL), BMP-2+Spp24 (100 ng/mL, 20 μg/mL) for 24 h. Subsequently, the cells were collected and centrifuged in 15mL centrifuge tubes and washed twice with PBS. For cell-cycle analysis, 1mL DNA Staining solution and 10μL permeabilization solution were added to all samples and then incubated at room temperature for 30 min in the dark according to the cell cycle staining Kit manufacturer’s instruction (Multiscience Biotech, Hangzhou, China). All samples were immediately analyzed by flow cytometry.
For apoptosis analysis, 5μL of annexin V-PE and 5μL of 7-amino-actinomycin D (7-AAD) were added to all samples, which were then incubated at room temperature for 15 min in the dark according to the manufacturer’s instruction (Thermo Scientific, Waltham, MA, USA). and the fluorescence intensity of the samples was immediately analyzed by flow cytometry.
Quantitative Real-time PCR
To examine the effects of BMP-2 and Spp24 on Smad signaling in osteosarcoma cells at the gene level, 143B and MG63 cells were seeded and grouped as Control, BMP-2 (100 ng/mL), Spp24 (20 µg/mL), BMP-2 + Spp24 (100 ng/mL, 20 µg/mL) in 6-well plates at a density of 1 × 105 cells/well and cultured for 24 hours. Total RNA was isolated by E.Z.N.A.® HP Total RNA Kit (Omega Bio-Tek, Norcross, GA, USA). 1 µg RNA was subjected to reverse transcription using the Prime-Script RT reagent kit (Takara, Shiga, Japan). Real-time PCR was performed with a 7300 Real-Time PCR system with SYBR® Premix Ex Taq™ (Takara, Shiga, Japan). The primer sequences used are listed in Table 1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was evaluated in separate tubes for each RT reaction as a standard. Relative gene expression was analyzed by the ΔΔCT method (10).
Table 1
Sense and anti-sense primers for Real-time PCR.
Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
Smad1 | TTTACAAGTCCAGCTGTGAAGA | AAAGCATCAACAGCTTTCTCTG |
Smad4 | ACAAGTAATGATGCCTGTCTGA | CTCCCATCCAATGTTCTCTGTA |
Smad5 | ACAATTGAAAACACTAGGCGAC | AGTTGCAGTTCCTACTCTGTAC |
Smad8 | GAAGTGTGCATTAACCCTTACC | ATATTCACTGTGTCTTGGCACG |
GAPDH | CAGCGACACCCACTCCTC | TGAGGTCCACCACCCTGT |
Western blotting analysis
143B and MG63 cells were seeded and grouped as Control, BMP-2 (100 ng/mL), Spp24 (20 μg/mL), BMP-2+Spp24 (100 ng/mL, 20 μg/mL) in 6-well plates at a density of 1×105 cells/well and cultured for 24 h. The cells were washed three times with PBS and lysed with RIPA buffer (150mM NaCl, 1% sodium deoxycholate, 0.1% SDS, 50mM Tris-HCl pH7.4, 1mM EDTA, 1mM PMSF, and 1% TritonX-100) supplemented with protease inhibitors and phosphatase inhibitors for 30 min at 4 °C. For western blotting analysis, a total of 20-30 mg of protein was separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electro-transferred onto nitrocellulose membranes. The primary antibodies used were rabbit monoclonal anti-Smad4 (Cell Signaling Technology,catalog #: 46535S ); rabbit monoclonal anti-Smad1/5/8 (Abcam, catalog #: ab80255); and rabbit monoclonal anti-phospho-Smad1/5/8 (Cell Signaling Technology, catalog #: 13820S). For normalization of protein loading, GAPDH antibody (Cell Signaling Technology, catalog #: 5174S) was used. The protein bands were visualized using an Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA).
Plasmid construction and transfection
BMP-2 and Spp24 cDNA was purified by Genechem (Shanghai, China) and cloned into the plvx-ires vector to generate plvx-ires-BMP-2-FLAG and plvx-ires-Spp24-GFP recombinant plasmids. Transient transfection was performed using the Lipofectamine™ 2000 transfection reagent (Invitrogen) following the manufacturer’s instructions. Scrambled lentiviral particles were used as the negative control. After 48 h of incubation, the medium was replaced with DMEM containing 5 μg/mL puromycin. After maintenance culture for 2-3 weeks in selection media, puromycin-resistant colonies were screened and selected for BMP-2 or Spp24 expression.
Co-immunoprecipitation (Co-IP)
Co-immunoprecipitation assays were performed using a co-immunoprecipitation kit (Thermo Scientific, Waltham, MA, USA). 143B cells were lysed in SDS lysis buffer on ice for 30 min, and after centrifugation at 4°C and 14, 000 ×g for 15 min, the supernatants were collected. The protein lysates were then incubated with anti-FLAG and anti-GFP antibody on a rotator overnight at 4°C. Then, the mixtures were incubated with immobilized protein A/G beads (Thermo Scientific) on a rotator for 2 h at 4°C. The beads were collected by centrifugation at 3000 × g for 2 min and washed five times with 0.5 mL of IP wash buffer. SDS loading buffer was then added to the beads, and the samples were denatured at 95°C for 10-12 min. Finally, the supernatants were collected and immediately analyzed by western blotting.
Transfection of Lenti-CMV-Firefly luciferase (FL)
143B cells were seeded at 2×105 cells per well in 6-well plates (Corning, USA) and cultured at 37°C overnight in mediums supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL). Transduction was performed in 1 mL of medium with Lenti-CMV-Fluc2 at a multiplicity of inflection of 5 (MOI = 5), including lentiviral vector supernatant and 1mg/ml of protamine sulfate. The cells were then washed with PBS 24h post-transduction and incubated in regular culture medium for another 48 h. A luminometer (Berthold Detection Systems, Pforzheim, Germany) was used to measure the FL luciferase activity following the manufacturer’s instructions (Promega). Each value was normalized to cell number or protein amount and calculated as the average of triplicate samples.
Implantation of tumor cells and test materials
All animal experiments were approved by the Animal Ethics Committee of Shanghai Ninth People’s Hospital. Forty-eight 8-week-old male BALB/c nude mice were purchased from Shanghai Super - B&K laboratory animal Corp. Ltd. Twenty-four nude mice received a subcutaneous injection of a total of 5.0×105 143B osteosarcoma cells in a volume of 200μL that contained 50μL of culture medium, 40 μL of growth factor reduced Matrigel (BD Biosciences, San Jose, CA, USA), and specified combinations of target proteins dissolved in PBS. The mice were divided into four groups as follows: Group 1, Control group with vehicle only; Group 2, 15 μg BMP-2; Group 3, 1.0 mg Spp24; Group 4, 15 μg BMP-2+1.0 mg Spp24. Mice were anesthetized with isoflurane delivered in oxygen and 70% ethanol was used to sterilize the overlying skin of the back. A 27.5-gauge needle was used to perform the subcutaneous injection on the lower left quarter of the back. Another twenty-four nude mice received a tibial injection of 1.0×105 143B osteosarcoma cells in a total volume of 50μL of culture medium with vehicle only (Group 1, control group); BMP-2 15 μg (Group 2); Spp24 0.5 mg (Group 3) and BMP-2 15 μg +Spp24 0.5 mg (Group 4). Mice were anesthetized with isoflurane delivered in oxygen and 70% ethanol was used to sterilize the overlying skin of the lower limb. Then 50 μL of mixtures containing cells were injected into the cavity of the proximal tibia through the proximal tibial plateau using a 27.5-gauge needle.
Imaging of tumors
Mice were anesthetized with 2% isoflurane delivered in oxygen and then subjected to intraperitoneal injection of 150 mg/kg of D-luciferin (Caliper LifeSciences, Hopkinton, MA). Twenty minutes after the injection, images were photographed using an IVIS cooled CCD camera (Xenogen, Alameda, CA). Images were analyzed with IGOR-PRO Living Image Software (Xenogen). The mice with subcutaneous xenografts were imaged on days 0 and 14 before excessive tumor growth could result in data outflow. The mice with intratibial xenografts were imaged on days 0 and 28 and the injected limbs were imaged with X-ray as well on day 28.
Measurement of tumor size and weight
For the subcutaneous tumors, tumor size was measured using an external caliper on days 0, 4, 7, 14 and 21, and the tumor volume was calculated according to the modified ellipsoidal formula (7). Mice receiving subcutaneous implantations were euthanized on day 21 and the tumor specimens were dissected out immediately. The tumor weight was measured using a precision electronic balance. Mice receiving tibial implantations were euthanized on day 28.
Histology and immunohistochemistry
143B cells were seeded at 1×104 cells per dish in 10mm confocal dishes. After cell attachment, all dishes were treated with BMP-2 or Spp24 as previously described and incubated for 24 hours. Cells were then rinsed with PBS, fixed in 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) for 15 min at room temperature, and permeabilized with 0.2% Triton X-100 followed by blocking with 0.5% BSA and 1% FBS. Cells were then stained with anti-PCNA, anti-Caspase6, or anti-phospho-Smad1/5/8, followed by Alexa 488 conjugated secondary antibody. Images were observed and photographed under fluorescent microscopy (Nikon Eclipse CI, Tokyo, Japan). The subcutaneous tumor specimens were fixed in 4% paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) at 4°C overnight before paraffin embedding. The intratibial tumor specimens were decalcification by submersion in Cal-Ex (Thermo Fisher; Waltham, MA) and then were washed with tap water. Hematoxylin and eosin (H&E) staining was performed on 5-µm sections for histological analyses. Immunohistochemistry to detect phospho-Smad1/5/8 in nude mouse xenograft tumor specimens was performed as previously described (7).
Statistical analysis
The data were presented as means ± standard deviation (SD) and were analyzed with SPSS version 22.0 (IBM, Armonk, NY). A value of P < 0.05 was considered statistically significant. Comparisons of two or more data sets were performed using one-way analysis of variance (ANOVA) with subsequent Tukey-Kramer comparisons. Student’s t-test was used for comparison involving two groups.