1 Identification of hAT-MSCs
The hAT-MSC cell line was a gift from Dr Zhenhua Hu (The Fourth Affiliated Hospital, College of Medicine, Zhejiang University, China). To further identify the hAT-MSCs, we conducted flow cytometric analysis and in vitro differentiation assays. To clarify the surface markers of MSCs, we utilized a Human Mesenchymal Stem Cell Multi-Colour Flow Kit (R&D Systems, Minneapolis, MN, USA) to label CD45, CD90, CD105 and CD146. hAT-MSCs were detached by trypsin and resuspended in PBS and then incubated in medium with antibodies for 30 mins. After washing with PBS, flow cytometric analysis was performed. To assess the differentiation potential of hAT-MSCs towards osteoblasts, adipocytes and chondroblasts, we induced the hAT-MSCs by osteogenic, adipogenic and chondrogenic media (Cyagen, Guangzhou, China), respectively. Cells were stained after 3-4 weeks of incubation. The hAT-MSCs were stained with Alizarin Red S (Sigma-Aldrich Co., St Louis, MO, USA), Oil Red O solution (Sigma-Aldrich Co., St Louis, MO, USA) and Alcian blue (Sigma-Aldrich Co., St Louis, MO, USA).
2 Cell culture
The HCC cell lines Hep3B and Huh7 were purchased from Shanghai Cell Bank, Chinese Academy of Sciences, HCCLM3 was established at our laboratory. Cells were cultured in DMEM (Biological Industries, Kibbutz Beit-Haemek, Israel) supplemented with 10% foetal bovine serum (Biological Industries, Kibbutz Beit-Haemek, Israel), penicillin (100 units/mL, Gibco, Carlsbad, CA, USA) and streptomycin (100 𝜇g/mL, Gibco). All cells were incubated under a humidified atmosphere at 37℃, 5% CO2. Hep3B (4 x 105), Huh7 (5 x 105) and HCCLM3 (6 x 105) were seeded into a 10-cm dish and cultured for 2 days. Then the HCC-conditioned medium was collected and filtered through a 0.22-𝜇m filter.
The hAT-MSCs from passage 2 (P2) to passage 3 (P3) were divided into 4 groups. Three of the groups were experimental groups that were cultured in Hep3B-conditioned medium (3B-CM), Huh7-conditioned medium (Huh7-CM) and HCCLM3-conditioned medium (LM3-CM) for 4-8 weeks and were marked as treated hAT-MSCs, with the medium replaced every 2 days. The other group was treated with normal medium as a control.
For phenotypic and metabolic reversal experiments, the treated hAT-MSCs were replaced in normal medium for another 2-4 weeks and were marked as R-3B-CM, R-Huh7-CM and R-LM3-CM, respectively.
Untreated hAT-MSCs (2 x 105), treated hAT-MSCs (2 x 105) and reversed hAT-MSCs (2 x 105) were seeded into a 10-cm dish and cultured for 3 days. Then the MSC-conditioned medium was collected and filtered through a 0.22-𝜇m filter. Then the HCC cells were divided into 4 groups, respectively. Three of the groups were experimental groups that were cultured in untreated hAT-MSC-conditioned medium (U-MSC-CM), treated hAT-MSC-conditioned medium (T-MSC-CM) and reversed hAT-MSC-conditioned medium (R-MSC-CM) for 3 days. The other group was treated with normal medium as a control.
3 Cell proliferation assays
hAT-MSCs (8 x 103) in each group (untreated hAT-MSCs, treated hAT-MSCs and reversed hAT-MSCs) and HCC cells (3 x 103) in each group (DMEM, U-MSC-CM, T-MSC-CM and R-MSC-CM) were seeded into 96-well plates, and cell proliferation was measured at different time-points using the Cell Counting Kit-8 (Dojindo Molecular Technologies Inc, Tokyo, Japan) for 96 hours according to the manufacturer’s protocol.
We also investigated the newly synthesized DNA of hAT-MSCs in each group using the EdU assay (RiboBio, Guangzhou, China). Cells (1 x 104) were seeded into 48-well plates and exposed to 50 μM 5-ethynyl-2'-deoxyuridine for 5 hours at 37℃. Then, the remaining procedures were all performed according to the manufacturer’s protocol.
4 Cell cycle analysis
Flow cytometry was applied for cell cycle analysis. Approximately 2 x 105 hAT-MSCs in each group were harvested and fixed in 75% ethanol for 24 hours at -20°C, and the cells were then stained with DNA staining solution (LiankeBio, Hangzhou, China) for 30 mins to detect cell cycle distribution.
5 Cell apoptosis assays
Approximately 5 x 105 hAT-MSCs in each group were harvested and then detected using an Annexin V-FITC/PI Apoptosis Detection Kit (LiankeBio, Hangzhou, China) according to the manufacturer’s protocol.
6 Transwell assays
The chemotaxis, migration and invasion assays were performed in Transwell chambers with 8 μm pore size (Corning, NY, USA). To measure the migratory capacity to different HCC-conditioned medium of hAT-MSCs, untreated hAT-MSCs (5 x 104) in 200 μL of serum-free medium were seeded in the upper chamber, and 800 μL of HCC-conditioned medium or DMEM with 10% FBS was placed in the lower chamber. The chambers were incubated at 37℃ for 20 hours. Subsequently, cells were stained with Crystal Violet Staining Solution (Beyotime, Shanghai, China). The number of cells that had migrated across the transwell membrane was counted based on the number of stained nuclei using an inverted microscope (Leica, Malvern, PA, USA).
For migration assays, hAT-MSCs in each group and HCC cells in each group (5 x 104) in 200 μL of serum-free medium were seeded in the upper chamber, and 800 μL of DMEM with 10% FBS was placed in the lower chamber. The remaining procedures were the same as the chemotaxis assay.
For invasion assays, 50 μL of diluted BD Matrigel (1: 8) was added to the upper chambers and incubated at 37℃ until completely solid. Then, hAT-MSCs in each group were added to the upper chambers, and the time of incubation was extended to 72 hours. The remaining procedures were the same as the chemotaxis assay.
7 Immunofluorescent assays
To determine the alterations of cytoskeleton structure, hAT-MSCs in each group (2 x 104) were seeded into 6-well plates. Cells were fixed in 4% paraformaldehyde (Saiguobio, Guangzhou, China) for 15 min and washed 2 times with PBS. Then, cells were permeabilized with 0.5% Triton X-100 (Solarbio, Beijing, China) for 15 mins and blocked with 5% BSA solution (Beyotime, Shanghai, China) for 1 hour with gentle agitation. After blocking nonspecific binding, the cells were incubated with primary antibodies against α-SMA (1:250, Abcam, Cambridge, MA, USA) overnight at 4℃. Then, the cells were washed for 3 times with PBS. Next, cells were stained with the FITC-labelled secondary antibody (Beyotime, Shanghai, China) and counterstained with DAPI (1:1000, 5μg/ml, Beyotime, Shanghai, China) to visualize the nuclei. Cells were observed using a fluorescence microscope.
8 Western blot analysis
Approximately 5 x 105 hAT-MSCs in each group were harvested, and total proteins were then extracted from the cells by incubating in RIPA cell lysis buffer with 1% PMSF and phosphatase inhibitors (Servicebio, Wuhan, China) on ice for 30 mins. After centrifugation (14,000 × g, 4℃, 15 mins), the supernatant was collected, and the total protein contents were measured using a BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Next, proteins were separated by 4%-12% SurePAGE Bis-Tris gels (Genscript, Nanjing, China) at consistent 120 V for 60 mins. Then, the proteins were transferred to PVDF membranes at consistent 350 mA for 60 mins. After the membranes were blocked using 5% BSA solution for 2 hours, the membranes were incubated overnight at 4℃ with primary antibodies against β-actin (1:2000, ab8226, Abcam), α-SMA (1:1000, ab32575, Abcam), Vimentin (1:1000, 10366-1-AP, Proteintech), Cyclin B1 (1:1000, ab32053, Abcam), Cyclin A2 (1:1000, 18202-1-AP, Proteintech), Cyclin D1 (1:1000, ab16663, Abcam), Cyclin E1 (1:1000, ab33911, Abcam), CDK1 (1:1000, ab18, Abcam), CDK2 (1:1000, ab32147, Abcam), CDK4 (1:1000, ab137675, Abcam), Bcl-2 (1:1000, 12789-1-AP, Proteintech), Caspase 3 (1:500, ab13847, Abcam), Bax (1:1000, 50599-2-Ig, Proteintech), GLUT1 (1:500, ab40084, Abcam), HK2 (1:1000, ab104836, Abcam), GPI (1:1000, 15171-1-AP, Proteintech), GAPDH (1:2000, ab9484, Abcam), PGK1 (1:1000, ab199438, Abcam), PKM2 (1:1000, ab85555, Abcam), LDH-A (1:1000, ab101562, Abcam), LDH-B (1:1000, ab75167, Abcam), HIF-1α (1:250, ab1, Abcam), AKT (1:1000, ab179463, Abcam), JNK (1:2000, 24164-1-AP, Proteintech), p38 (1:1000, 14064-1-AP, Proteintech), ERK1/2 (1:1000, ab17942, Abcam), p-AKT (1:1000, ab81283, Abcam), p-JNK (1:2000, AF3318, Affinity), p-p38 (1:1000, AF4001, Affinity) and p-ERK1/2 (1:1000, ab201015, Abcam). After washing 3 times with TBST, the membranes were incubated with secondary anti-mouse or anti-rabbit antibodies (1:3000, Servicebio, Wuhan, China) for 1 hour at room temperature. Detection was carried out using the ECL kit (Servicebio, Wuhan, China).
9 Glucose uptake, lactate, pyruvate and ATP assays
The Glucose Uptake Colorimetric Assay Kit (BioVision, Milpitas, CA, USA), Lactate Colorimetric Assay Kit II (BioVision), Pyruvate Colorimetric Assay kit (BioVision) and ATP Colorimetric Assay Kit (BioVision) were used to determine glucose uptake and levels of lactate, pyruvate and ATP, respectively, according to the manufacturer’s protocols.
10 Mitochondrial staining
To stain mitochondria, we used Mito-Tracker Green (100nM, Beyotime, Shanghai, China) to mark mitochondrial mass and JC-1 (10μg/ml, Beyotime, Shanghai, China) to mark mitochondrial membrane potential (MMP). hAT-MSCs in each group (2 x 104) were seeded into 6-well plates. After 24 hours, cells were incubated with Mito-Tracker or JC-1 staining solution for 30 mins at 37℃. Later, cells were washed in normal medium. Cells were observed using a fluorescence microscope.
11 RNA extraction and quantitative real-time PCR
Total cellular RNA was extracted using an RNA-Quick Purification Kit (Yishan Biotechnology Co., Shanghai, China) and reverse transcribed to cDNA using a HiScript RT kit (Vazyme, Nanjing, China) in accordance with the manufacturer's protocol. RT-qPCR was performed using specific primers for the quantification of GLUT1, HK2, GPI, GAPDH, PGK1, PKM2, LDHA, IL-1β, IL-6, IL-8, TGF-β, TNF-α, CCL-2 and CCL-7 (Table 1). β-actin was used as a control. Reactions were performed using the ChamQ universal SYBR master mix (Vazyme, Nanjing, China) in the Bio-Rad CFX96 Real-Time System. mRNA expression was calculated using the 2–ΔΔCT method.
Table 1 Primer sequences of target genes
Gene
|
Primer sequences
|
β-actin
|
F: AGGGGCCGGACTCGTCATACT
R: GGCGGCACCACCATGTACCCT
|
GLUT1
|
F: CATCCCATGGTTCATCGTGGCTGAACT
R: GAAGTAGGTGAAGATGAAGAACAGAAC
|
HK2
|
F: GCCATCCTGCAACACTTAGGGCTTGAG
R: GTGAGGATGTAGCTTGTAGAGGGTCCC
|
GPI
|
F: TATTGTGTTCACCAAGCTCACACC
R: TGGTAGAAGCGTCGTGAGAGGTC
|
GAPDH
|
F: TTCCGTGTCCCCACTGCCAACGT
R: CAAAGGTGGAGGAGTGGGTGTCGC
|
PGK1
|
F: ATGTCGCTTTCTAACAAGCTGA
R: GCGGAGGTTCTCCAGCA
|
PKM2
|
F: GCCCGTGAGGCAGAGGCTGC
R: TGGTGAGGACGATTATGGCCC
|
LDHA
|
F: ATGGCAACTCTAAAGGATCA
R: GCAACTTGCAGTTCGGGC
|
IL-1β
|
F: GTGAGTAGGAGAGGTGAGAGAGG
R: ATAGCCTGGACTTTCCTGTTGTC
|
IL-6
|
F: TACATCCTCGACGGCATCTC
R: AGCTCTGGCTTGTTCCTCAC
|
IL-8
|
F: GCTCTGTGTGAAGGTGCAGTTT
R: TTCTGTGTTGGCGCAGTGT
|
TGF-β
|
F: GAGGTGACCTGGCCACCATT
R: TCCGCAAGGACCTCGGCTGG
|
TNF-α
|
F: CCGAGTGACAAGCCTGTAGC
R: AGGAGGTTGACCTTGGTCTG
|
CCL-2
|
F: GAACCGAGAGGCTGAGACTA
R: GCCTCTGCACTGAGATCTTC
|
CCL-7
|
F: GACAAGAAAACCCAAACTCCAAAG
R: TCAAAACCCACCAAAATCCA
|
12 Measurement of ROS
Intracellular ROS were measured using a Reactive Oxygen Species Assay Kit (Yeasen Biotech Co., Shanghai, China). Approximately 2 x 105 hAT-MSCs in each group were harvested and incubated with 10 μM DCFH-DA Solution for 30 min at 37℃. The remaining procedures were performed in accordance with the manufacturer’s protocol.
13 Statistical analysis
Data are presented as the mean ± SD of three independent experiments. All statistical analyses were performed in GraphPad Prism version 8.0 software (GraphPad Software Inc, San Diego, CA, USA) using one-way or two-way ANOVA. For all statistical tests, the level of p<0.05 was considered as significance.