Collection of tissue samples
NSCLC tissues and adjacent normal lung tissues (at least 5 cm away from tumor tissues) were harvested from 73 patients diagnosed with primary NSCLC and underwent tumor resection at Jiangxi Tumor Hospital from December 2013 to June 2015. None patients received radiotherapy or chemotherapy before surgery. Patients combined with other chronic diseases were excluded. The obtained tissues were snap frozen and kept in liquid nitrogen at -80 °C until later experiments. The patients were visited every month to collect and record the prognostic survival. The detailed information of all patients is listed in Table 1.
Table 1
Detailed characteristics of the 73 patients
| Group | n |
Sex | Male | 48 |
Female | 25 |
Age | ≤ 60 | 27 |
> 60 | 46 |
TNM stage | Ⅰ-Ⅱ | 31 |
Ⅲ-Ⅳ | 42 |
History of smoking | Yes | 55 |
No | 18 |
Cell treatment and transfection
The cultured two normal lung epithelial cell lines Beas-2B and HBE, NSCLC cell lines 95D, A549, NCI-H520, NCI-H460 and H1299 as well as human embryonic kidney 293T (HEK293T) cells were from ATCC. No mycoplasma contamination was confirmed by the cellosaurus query website. Normal lung epithelial cell lines Beas-2B and HBE were cultured in LHC-9 medium. 95D, A549, NCI-H520, NCI-H460, H1299 and HEK293T cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) with 1% penicillin/streptomycin (Invitrogen) and 10% fetal bovine serum (HyClone, Logan, UT) in a 5% CO2 incubator at 37 °C.
The A549 cells were trypsinized and resuspended into 1 × 103 cells/mL single cell suspension with serum-free DMEM/F12 culture medium containing epidermal growth factor, basic fibroblast growth factor, insulin, bovine serum albumin, B27 and glucose. The culture flask was vertically placed in the incubator and shaken 5 times a day to observe the formation of microspheres. Half of the medium was renewed once every 2 days, and the cells were passaged every 6 days. The microspheres in logarithmic growth phase were collected, detached with Accutase, triturated into single cells and incubated with Hoechst 33342. Flow cytometry was applied to detect the side population (SP) cells. When the proportion of the SP cells reached 25%, all spheres were collected and made into a single cell suspension with phosphate buffered saline (PBS). The cell suspension was incubated with the monoclonal antibody labeled with fluorescence to sort CD133+ and CD44+ cells as A549 stem cells with a fluorescent activated cell sorter.
Negative control (NC) mimic, miR-103a mimic, NC inhibitor, miR-103a inhibitor, overexpressed (oe)-NC, oe-OTUB1 vectors were generated by Life technologies (Grand Island, NY) and delivered into the cells to a final concentration at 20 nM. According to the instructions for FuGENE6 transfection reagent (Promega, Madison, WI), A549 cells were cultured overnight and transfected once reaching 60% confluence. Cells were collected 24 h or 48 h after transfection.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from cells and tissues using Trizol (Invitrogen). Nanodrop spectrophotometer 2000 (1011U, NanoDrop Technologies, Wilmington, DE) was applied to determine the concentration and purity of total RNA. The reverse transcription was performed according to the TaqMan MicroRNA Assays Reverse Transcription primer (4427975, Applied Biosystems, Inc., Foster City, CA) instructions to produce cDNA. The qPCR primers were all commissioned to Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China) for synthesis (Table 2). ABI 7500 quantitative PCR instrument (7500, ABI, Oyster Bay, NY) was used for real-time fluorescence quantitative PCR detection. U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as endogenous controls for detection of miRNA and gene expression, respectively. Relative quantification (2−ΔΔCt) method was used for fold changes’ calculating.
Table 2
Targets | Sequence (5’-3’) |
miR-103a | F: AGCAGCATTGTACAGGGCTAT R: GTGCAGGGTCCGAGGT |
OTUB1 | F: TCCTACAGGTCTCAGGTCCG R: GCTCTGACACCAGAGGGTTC |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT |
GAPDH | F: GAAGGTGAAGGTCGGAGT R: GAAGATGGTGATGGGATTTC |
Note: miR-103a, microRNA-103a; OTUB1, ovarian tumor domain-containing ubiquitin aldehyde binding protein 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. |
3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetr-azolium (MTS) assay
A549 cells were plated in a 96-well plate (Corning Co, Corning, NY) at a rate of 1 × 103 cells each well and cultured with 5% CO2 at 37 °C. The cell viability was detected in each group using a CellTiter96 Aqueous One Solution Cell Proliferation Assay Kit (Promega) after 24 h of cell transfection. The cells were grown for 2 h with MTS reagent at 37 °C with 5% CO2. The optical density (OD) value at 490 nm was measured using a SpectraMax 340PC384 microplate reader to assess cell proliferation.
Flow cytometry
After 48 h of transfection, the cells at the confluence of 80%-90% were detached with trypsin and fixed with 70% ethanol in PBS at -20 °C overnight. Cell suspension (1 × 106 cells/mL) was incubated with 50 µg/mL propidium iodide in PBS avoiding light for 10 min. The apoptosis and cycle distribution of the cells was determined using an Attune NxT flow cytometer (Thermo Fisher Scientific Inc., Waltham, MA).
Determination of cell migration and invasion
Matrigel (Corning) was diluted with Roswell Park Memorial Institute (RPMI)-1640 medium (Solarbio, Beijing, China) and added into the chamber dropwise. Cells suspended in RPMI-1640 medium (1 × 104 cells/mL) were seeded into 6-well plates, while 500 µL RPMI-1640 medium supplemented with 10% fetal bovine serum was placed in the basolateral chamber. After an incubation for 24 h at 37 °C with 5% CO2, the cells in the basolateral chamber were washed with PBS, fixed in 4% paraformaldehyde for 30 min at room temperature and stained with 0.5% crystal violet staining solution for 30 min. After being fixed with neutral gum (Sigma-Aldrich Chemical Company, St Louis, MO, USA), five visual fields were randomly selected under an inverted microscope (Eclipse Ti, Nikon, Japan) for photograph and calculating the invaded cell number. Matrigel was not added in the cell migration assay, and the other steps were the same as the invasion assay.
Sphere formation assay
The pretreated cells were resuspended in DMEM/F12 medium (500–1000 cells/mL) and then cultured for 12 days in 6-well ultra-low attachment petri dishes (Corning). The number and size of tumor spheres were counted and measured using a contrast microscope (EVOS M7000, Nikon, Japan) at the 12th day to analyze the growth of tumor spheres.
Western blot
After 48 h of cell transfection, the cells were lysed on ice with radio immunoprecipitation assay solution, and centrifuged at 20000 × g for 10 min at 4 °C to gather the supernatant. Subsequently, 15 µg total protein was subjected to 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and then electroblotted onto a nitrocellulose membrane. Protein concentrations were determined with a bicinchoninic acid assay kit (Abcam Inc., Cambridge, UK). The proteins were then incubated with primary rabbit antibodies against OTUB1 (ab175200), YAP (ab52771) and p-YAP (ab76252) as well as goat anti-rabbit IgG (ab97051) at 4 °C. All antibodies were from Abcam. Immunoreactive bands were measured using the enhanced chemiluminescence detection Kit (Thermo Fisher Scientific).
Dualluciferase reporter assay
We synthesized oligonucleotides in OTUB1 mRNA 3’untranslated region (3’UTR) containing targeting sequences with miR-103a. Meanwhile, miR-103a overexpression vector, inhibitor vector and vector containing miR-103a mutation were designed. The targeting sites were mutated to construct miR-103a mutant. The pGLO vector was selected to construct the fluorescence reporter vector pGLO-OTUB1. The vectors were extracted using a plasmid purification kit (Invitrogen). 293T cells were cultivated in a 24-well plate. The 200 ng pGLO-OTUB1 plasmid and 20 nM miR-103a mimic, inhibitor or mutant were co-transfected for a total of 24 h before the cell lysates were collected and the luciferase activity was determined by the dual luciferase reporter system (E1910, Promega). Firefly luciferase activity was used as a normalizer.
Statistics
SPSS 22.0 statistical software (IBM Corp. Armonk, N.Y., USA) was applied for all statistical analysis. All data are displayed as the mean ± standard deviation. Comparisons between two groups were analyzed by paired t test (between normal tissues and tumor tissues) or unpaired t test (other two groups), while comparisons among multiple groups were assessed by one-way or two-way analysis of variation (ANOVA), followed by Tukey’s post hoc test. The survival of patients was evaluated using Kaplan-Meier analysis. p value < 0.05 was symbolic of a significant difference.