Reagents
All chemicals used in the experiments were of analytical grade. Melatonin (N-acetyl-5-methoxytryptamine) was purchased from Sigma-Aldrich (St. Louis, MO, USA). All other reagents were purchased from Sinopharm Chemical Reagent Beijing Co., Ltd, (Beijing, China).
Plant materials
The following experiments were conducted in the laboratory at Hebei Agricultural University, Baoding (38.85°N, 115.30°E), China. GXM9 (Gossypium hirsutum L.), a commercial cotton cultivar used locally, was used in this study. This cultivar was developed by the Guoxin Rural Technical Service Association of Hejian Co., Ltd, (Hebei, China ). Briefly, similar seeds were screened according to their size and mass.
Germination tests
A NaCl concentration of 150 mM and melatonin concentration of 20 µM were selected for seed germination [69]. Five hundred cotton seeds were sterilized with 75% ethanol for 17 min and rinsed in distilled water four times. They were then divided into three treatment groups: CK (germination of seeds pretreated with just water); S (germination of seeds pretreated in 150 mM NaCl under salt stress); and SM (germination of seeds pretreated in 20 µM melatonin under 150 mM NaCl solution). Each group was soaked in the different solutions for 24 h and then placed onto an ultra-clean table to dry. One hundred cotton seeds were spread across a total of five Petri dishes (15 cm × 15 cm) with filter paper (Whatman International Ltd.) and cultured at 25 °C and 50% humidity for 7 d in an incubator in the dark. Seed germination was characterized by the emergence of the germinating root tip through the seed coat and the appearance of a visible radicle. Seed germination potential and germination rate were recorded on the third and seventh day, respectively. All phenotypic measurements included six independent biological repeats.
Germination rate (%) = (number of germinated seeds by day 7/ total number of test seeds) x100
Germination potential (%) = (number of germinated seeds by day 3/ total number of test seeds) x100
Germination index = ∑(Gi / Ti), where Gi is the germination percentage of the ith day, and Ti is the day of the germination test.
Morphological observation and determination of hypocotyl length
Cotton seeds from the three treatments (CK, S, SM) were placed in incubators (25 °C and 50% humidity) for 7 d. Cotton seed morphology was observed at 2, 4, and 6 d. The hypocotyl length of 20 cotton seeds was measured on day 7 with a Vernier caliper. Six independent biological repeats were measured.
Determination of α-amylase, β-galactosidase, and starch content
Cotton seeds from the three treatments (CK, S, SM) were placed in incubators for 7 d. The activity of α-amylase (α-AMS) and β-galactosidase (β-GAL) in the cotton seeds was measured on the 7th day of cotton seed germination according to the manufacturer’s protocol of the kit from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Six independent biological repeats were measured. All samples were rapidly frozen in liquid nitrogen and stored at − 80 °C before analysis.
Fresh germinating seed samples of 0.3 g were weighed and combined with 2.7 mL of phosphate buffer. The mixture was ground thoroughly at a low temperature (0–4 °C), swirled, and mixed for 3 min, following which it was centrifuged at 3500 g for 10 min. The supernatant was collected and stored at − 80 °C until analysis by the Nanjing Jiancheng Bioengineering Institute. The starch content was measured on the 7th day of cotton seed germination using a starch kit from the Nanjing Jiancheng Bioengineering Institute.
Extraction and determination of melatonin
Melatonin was extracted from 20 cotton seeds at four time points (0, 6, 12, 24 h) from the beginning of the seed germination trial according to Pothinuch et al. [70], with slight modifications. Three independent biological repeats were assessed. All samples were rapidly frozen in liquid nitrogen and stored at − 80 °C before analysis.
Cotton seeds (0.3 g) were ground in liquid nitrogen, combined with 2 mL sample extract, ground into a homogenate in an ice bath, and extracted for 4 h. The solution was then centrifuged at 1000 g at 4 °C for 15 min, following which the supernatant was transferred to a 10 mL Eppendorf tube for storage at 4 °C. This process was repeated three times. The supernatants were applied to C-18 cartridges (Sep-Pak Vac 3 cc, C18 Cartridges, Ireland), and the eluate was collected. The collected samples were dried under a nitrogen stream to remove the methanol, and a certain volume of diluent was added for sample determination. The melatonin content was determined by enzyme linked immunosorbent assay (ELISA) using the Plant MT ELISA KIT produced by Shanghai MLBIO Biotechnology Co. Ltd (Shanghai, China). Data were analyzed using a microplate reader (Bio Tek Instruments, Inc, USA) following the manufacturer’s instructions.
Extraction and assay of phytohormone ABA and gibberellin (GA3)
ABA and GA in the seeds were determined at different time points (0, 6, 12, 24 h) during the germination phase using an ELISA kit provided by China Agricultural University and included three independent biological repeats. All samples were rapidly frozen in liquid nitrogen and stored at − 80 °C before analysis.
Cotton seeds weighing 0.3 g were combined with 2 mL of sample extract, ground into a homogenate in an ice bath, and transferred to a 10-mL test tube. The mortar was rinsed with 2 mL of extract, and the solution was transferred to a test tube and shaken well, following which it was placed into a refrigerator at 4 °C. The extract was extracted at 4 °C for 4 h and then centrifuged at 1000 g for 15 min. The supernatant was obtained, and 1 mL of the extract was added to the pellet, stirred evenly, and then extracted at 4 °C for 1 h. The mixture was then centrifuged for 15 min, mixed with the supernatant, and the volume recorded. The supernatant was passed through C-18 (Sep-Pak Vac 3 cc, C18 Cartridges, Ireland) solid-phase extraction columns and then transferred to a 5-mL plastic centrifuge tube, concentrated under vacuum or dried under nitrogen to remove the methanol, and then diluted to a constant volume in accordance with the protocol of the China Agricultural University Kit. The samples were incubated with antibodies and measured at 492 nm with a microplate reader (Bio Tek Instruments Inc., USA).
RNA isolation and quantitative real-Time PCR (qRT-PCR) analysis
The total RNA of the cotton seeds at different time points (0, 6, 12, 24 h) was extracted using an EASYspin Plus Kit (Alidlab company USA) according to the manufacturer’s protocol. About 100 mg of each sample was extracted after germination by the liquid nitrogen grinding method. The RNA concentration and purity were assessed on a NanoDrop 2000 spectrophotometer, and only RNA samples with A260/A280 > 1.8 and A260/A230 > 2.0 were used for cDNA synthesis. Total RNA of 2 µg was reverse transcribed using a PrimeScript 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The primer sequences used for the qRT-PCR analysis were designed by Primer Premier 6.0 software (Primer Premier, Canada). The qRT-PCR reaction mixture was composed of 10 µL of AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China), 8.5 µL of deionized water, 1 µL of five-fold diluted template, and 0.5 µL of each amplification primer. The cycling conditions were set as follows: initial denaturation of 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 30 s. Relative expression levels were calculated according to the 2−△△CT method [71]. GhHIS was used as an internal reference gene. The primer sequences for qRT-PCR of the signal transduction genes in cotton are shown in Table 1.
gene name
|
Primer sequences (5’-3’)
|
GhHIS
|
F: ATACCGTCCTGGAACTGTTGCTCT
|
R: TTCAAAAAGACCCACAAGGTATGC
|
GhABF2
|
F: CCAATTTGCTGGGAAGGATAA
|
R: GGTAACTGGTGCTGGTTTGATT
|
GhDPBF2
|
F: CAAACTTCGGGATGGGACA
|
R: TCTAACAGGCGGTTGGTGC
|
GhGID1C
|
F: TCGCAAAGTCCCTGCTAATG
|
R: AGCTTCCACCGTGAAAGAAAA
|
GhGID1B
|
F: GTTCGGTGGGCAGATGAGA
|
R: TGAGACCTTCGAGGGTTCG
|
Table 1
Primers designed by qRT-PCR.
RNA-Seq quantitative analysis
Quantitative RNA-Seq analysis of the cotton seeds at different time points (0, 6, 12, 24 h) was performed by Beijing Nuohe Zhiyuan Tech Co. Ltd. (Beijing, China). Total RNA was extracted with TRIzol and the concentration of RNA was accurately determined using a Qubit2.0 fluorometer. The integrity of the RNA was detected by an Agilent 2100 bioanalyzer.
The library was constructed using the NEBNNext RNA Library Prep Kit from Illumina, and the starting RNA of the library was total RNA. After the library was constructed, a preliminary quantification was performed using a Qubit 2.0 fluorometer. The insert size of the library was then detected by an Agilent 2100 bioanalyzer, and the effective concentration of the library was quantified by qRT-PCR.
Differential expression analysis of the two comparisons was performed using DESeq2 software (1.16.1). Cluster profiler software was used to perform Gene Ontology (GO) enrichment analysis of the differentially expressed genes and to statistically analyze the differentially expressed genes in the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways.
Statistical analysis
The experiment was conducted according to a completely randomized design with six replications per treatment group. The data were expr essed as the mean ± standard error, and statistical analysis was conducted with SPSS software 22.0 (IBM Corp, Armonk, NY, USA). Tukey’s post-hoc tests were used to determine which means differed significantly. A P-value of < 0.05 indicated a significant difference. Graphs were drawn using GraphPad Prism 5.0 (GraphPad Software, Inc. USA).