Study design and sample collection
This cross-sectional study was conducted at AJA University of Medical Sciences from September 2020 to February 2021. Patients presenting different symptoms and clinical signs of respiratory tract infection were included in this study. All participants provided written informed consent before enrolment. After informed consent, sociodemographic data and clinical signs including age, height, weight, blood type, types and times of facemasks used during COVID-19 pandemic, a history of high blood pressure, a history of lung diseases such as chronic obstructive pulmonary disease (COPD), a history of asthma disease, obesity, irritable bowel syndrome (IBS), diabetes, a history of the liver disease (fatty liver disease), contact with a person who has a positive test to COVID-19, alcohol consumption, smoking, fever, chills, cough, muscle aches, lethargy, red eyes, diarrhea, vomiting, nausea, runny or stuffy nose, gastrointestinal bleeding, sore throat, chest pain, headache, dyspnea, changes the sense of smell and taste, loss of consciousness, and joint pain were recorded. The samples were collected by the nasopharyngeal swabs (flock swabs, Copan, Italy) in 10 ml of sterile phosphate-buffered saline (PBS, 0.1M, pH 7.2) and were transported to the Comprehensive Research Laboratory, School of Medicine, AJA University of Medical Sciences. The three nasopharyngeal swab samples were taken from each included patient.
DNA extraction and detection of bacterial respiratory pathogen
The first nasopharyngeal swabs were placed in 1 ml of sterile saline and mixed by vigorous vortex for 30 to 45 s. At the next step, swabs were removed from samples and saline suspensions were transferred to a 1.5 ml Eppendorf tube. The Eppendorf tubes were centrifuged at 13000 rpm for 5 min and pellet suspended in 300 µl 20% Chelex in TE buffer and then heated at 95°C for 5 min to disrupt the cells. All samples were stored at -20°C. For the detection of B. pertussis, the specific primers which targeted the IS481 gene were used. The primer sequence used for the detection of B. pertussis were as follows: PIp1-F: 5′-CCCATAAGCATGCCCGATTGAC-3′ and PIp2-R: 5′-CGCACAGTCGGCGCGGTGAC -3′. The PCR assay was carried out in a total volume of 50 μl reaction containing 5 mM MgCl2, 6 μl of 10x PCR buffer, 1 μM of each forward (Pip1) and reverse (Pip2) primers (10mM), 2 units of Taq polymerase (Cinnagene, Iran), 1 μl of 10 mM of each deoxynucleoside triphosphate (dNTPs), 10 ml of the stored clinical sample and sterile distilled water up to 50 μl. The PCR reaction condition and parameters were similar to those described by Brandberg et al[15].
To detection of M. pneumoniae, swab samples were placed in microtubes containing phosphate-buffered saline (PBS), and then DNA extraction was conducted using a MagNa Pure LC DNA I isolation kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s guidelines. The semi-nested PCR method was used to screen the presence of M. pneumoniae in the swab samples. Briefly, M. pneumoniae DNA was amplified and detected using the first-round primer pairs including 5′-TGCCATCAACCCGCGCTTAAC-3′ and 5′-CCTTTGCAACTGCTCATAGTA-3′ and the second-round primers including 5′– CCTTTGCAACTGCTCATAGTA -3′ and 5′-CAAACCGGGCAGATCACCTTT-3′. The semi-nested PCR conditions and parameters were set based on a previously published study by Nilsson et al[16].
The detection of S. pyogenes was performed with the PCR method and using specific primer pairs including F: 5′-AAAGACCGCCTTAACCACCT- 3′ and R: 5′-TGGCAAGGTAAACTTCTAAAGCA-3′ target the spy1258 gene. PCR was conducted in a total volume of 25 μl reaction including 3 μl of 10× PCR buffer without MgCl2, 2.5 mmol/l MgCl2, 0.5 μl of 10mM of each deoxynucleoside triphosphate (dNTPs), 0.5 μM of each primer (10 mM), 1 unit of Taq polymerase (Cinnagene, Iran), 5 μl of template DNA, and 5.5 μl of sterile distilled water. PCR program of spy1258 gene is followed by initial denaturation for 2 min at 94 ºC, 35 cycles of denaturation for 35 s at 94 ºC, annealing for the 20s at 55 ºC, elongation for 40 s at 72 ºC, and final elongation for 2 min at 72 ºC.
For H. influenzae detection, the multiplex PCR method target genes HiP6 and bexA were used. The primers sequences were as follows: HiP6-F: ACTTTTGGCGGTTACTCTGT and HiP6-R: TGTGCCTAATTTACCAGCAT, bexA-142-F: GGCGAAATGGTGCTGGTAA and bexA-241-R: GGCCAAGAGATACTCATAGAACGTT. PCR was performed on Eppendorf Mastercycler EP thermocycler and PCR programs are followed by initial denaturation for 5 min at 94 ºC, with 35 cycles of 95 ◦C for 30 s, annealing for the 60 s at 50 ◦C, an extension for 1 min at 72 ºC, and final extension for 10 min at 72 ºC. Finally, all PCR products were electrophoresed and screened on a 1-1.5% agarose gel, and then stained with DNA-safe stain (SinaClon, Tehran, Iran). PCR products were visualized by a UV transilluminator and photographed under UV light.
RNA extraction and complementary DNA synthesis
Total viral RNA was extracted from 200 μl of nasopharyngeal swab samples using the QIAamp Viral RNA Mini kit (Qiagen, Mississauga, Ontario, Canada) according to the supplier’s instructions. To remove any genomic DNA carryover, 20 U of RQ1 RNAse-free DNAse (Promega, Madison, WI, USA) was used and then extraction was suspended in 50 μl of diethyl pyrocarbonate-treated water (0.1% v/v). The complementary DNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, ON, Canada). Synthesis conditions have been described by MacIntyre et al[6].
Detection of viral respiratory pathogens
Nested PCR was used for detecting adenoviruses using specific primer pairs. In brief, adenoviruses DNA was amplified and detected using the first-round primer pairs including 5′-GCCGCAGTGGTCTTACATGCACATC-3′ and 5′-CAGCACGCCGCGGATGTCAAAGT -3′ and the second-round primers including 5′-GCCACCGAGACGTACTTCAGCCTG-3′ and 5′-TTGTACGAGTACGCGGTATCCTCGCGGTC-3′. PCR conditions were set based on a previously published study by Rigotto et al[17]. PCR reactions were conducted under the following condition: initial denaturation at 95 °C for 5 min followed by 40 cycles at 95 °C for 1 min, annealing at 56°C for 1 min, and 72 °C for 45 s with the final incubation at 72 °C for 7 min.
The probe-based real-time PCR was used to detection of influenza A and B viruses. For detection of influenza A and B viruses in nasopharyngeal swab samples, the primes and probes target the matrix protein (M) and hemagglutinin gene segment (HA) genes, respectively. Complementary DNA was amplified using the following primer and probe: M-F: 5′- GGACTGCAGCGTAGACGCTT-3′, M-R: 5′- CATCCTGTTGTATATGAGGCCCAT-3′, probe: 5′-FAM-CTCAGTTATTCTGCTGGTGCACTTGCCA-TAMRA-3′, and HA-F: 5′-AAATACGGTGGATTAAATAAAAGCAA-3′, HA-R: 5′-CCAGCAATAGCTCCGAAGAAA-3′, probe: 5′-FAM-ACCCATATTGGGCAATTTCCTATGGC-TAMRA-3′. Real-time PCR conditions were set based on a previously published study by Elden et al[18]. In summary, the reaction was performed with the final volume of 25 μl including 12.5 ml of TaqMan Universal PCR master mix containing ROX as a passive reference (PE Applied Biosystems), 5 μl of cDNA, 1 μl of each influenza virus A and B primers, 100 nM each probe, and sterile distilled water up to 25 μl. The real-time PCR was conducted on a Corbett 6000 Rotor-Gene thermocycler (Corbett Research) under the following conditions: 50°C for 2 min (optimal AmpErase Uracil-N-glycosylase activity) followed by of 95 °C for 10 min, 45 cycles of 95 °C for 20 s and of 60 °C for 1 min. During amplification procedures, the fluorescence radiating from the used probes was documented.
Detection of COVID-19 by One-Step Quantitative RT-PCR System
Detection of COVID 19 was performed with one step qRT-PCR method. For this purpose, the primers and probes target the RdRp genes (nCoV_IP2 and nCoV_IP4). The primers and probes sequence used for the detection of viral RNA were as follows: nCoV-IP2-F: 5'-ATGAGCTTAGTCCTGTTG-3', nCoV-IP2-R: 5'-CTCCCTTTGTTGTGTTGT-3', nCoV-IP2-12696bProbe: 5'-Hex-AGATGTCTTGTGCTGCCGGTA-3'-BHQ-1 and nCoV-IP4-F-5'-GGTAACTGGTATGATTTCG-3', nCoV-IP4-F-5'-CTGGTCAAGGTTAATATAGG-3', nCoV-IP4-14084Probe: 5'-Fam-TCATACAAACCACGCCAGG-3'-BHQ-1. Moreover, we used RNase P (C1), labeled with BHQ-1 and HEX fluorescent dye as an internal reference control. Quantitative RT-PCR was performed with a Kit Extraction NucleoSpin Dx Virus (Macherey Nagel ref. 740895.50) and Invitrogen Superscript™ III Platinum® One-Step qRT-PCR system (ref: 11732-088). The optimized concentrations were performed in a total volume of 25 μl reaction including 3.6 μl sterile distilled water, 12.5 μl Reaction mix 2X (3 mM Mg), 0.4 μl MgSO4 (50mM), 1 μl of each primer (10 mM), 0.5 μl of Probes (10μM), 1 μl superscriptIII RT/Platinum Taq Mix, and 5μl of extracted RNA sample. Amplification condition was as follows: reverse transcription for 20 min at 55°C, denaturation for 3 min at 95°C, 50 cycles of denaturation for 15 s at 95°C, annealing for the 30s at 58°C, and cooling for 30s at 40°C. Cycle threshold (CT) value equal to or less than 30 was considered to be positive.
Statistical Analysis
All sociodemographic and clinical data of patients were formatted in an SPSS file, and the data were analyzed by the statistical package SPSS v.23.0 (SPSS Inc., Chicago, IL, USA) using descriptive statistic tests.