1. Study subjects and grouping
The study subjects were from May 2012 to March 2017 at the Department of Infectious Diseases, General Hospital of Ningxia Medical University. Based on the inclusion and exclusion criteria, 181 cases were finally identified as eligible for enrollment in the study, 28 patients with chronic hepatitis B (CHB), 31 patients with liver cirrhosis (LC), 104 patients with liver cancer (HCC) and 18 cases in the healthy population (NC). All subjects signed an informed consent form prior to the survey sampling. The study protocol and all amendments were approved by the institutional review board or ethics committee of participating site and were conducted per the principles expressed in the Declaration of Helsinki. All patients provided written informed consent to participate.
1.1 Criteria for diagnosis, inclusion and exclusion
1.1.1 Diagnostic conditions
Chronic hepatitis B, cirrhosis and liver cancer were diagnosed according to the Asian Pacific Association for the Study of the Liver (APASL), the European Association for the Study of the Liver (EASL) and the American Association for the Study of Liver Diseases standards [17]. Liver function status was graded according to the Child Class score and the MELD (Model for end-stage liver disease, MELD) [18]. Patients with hepatocellular carcinoma were staged according to the American Joint Committee on Cancer 6th edition TNM staging criteria [19]。
1.1.2 Criteria for inclusion and exclusion
Criteria for patient inclusion: Patients who meet the diagnostic criteria of 1.1.1 and have a confirmed diagnosis of chronic hepatitis B, cirrhosis or hepatocellular carcinoma. Exclusion criteria for liver cancer are: ① Liver cancer not due to hepatitis B infection; ②Improper clinical information; ③Patients with recent serious infections, surgery, trauma and other diseases. Exclusion criteria for chronic hepatitis B are: ①Patients with viral hepatitis not caused by hepatitis B virus; ②Patients who have progressed to the cirrhotic stage of the liver.
③Patients with recent serious infections, surgery, trauma, etc.
2 Research Methodology
2.1 Collection of general data
Basic information was collected on all study subjects. This includes: Age, Gender, diagnosis, previous medical history (history of tumor, history of surgery). Anthropometric height measurement: After fasting overnight, study subjects will have their height measured on a meter on the day of the blood draw (refer to the Chinese Adult Body Mass Measurement Standard). The subject should be barefoot and stand in a standing position on the meter with both eyes level. Results of alanine transaminase (ALT) and aspartate transaminase (AST) tests were collected from all patients with liver disease. Clinical characteristics of 104 patients with liver cancer were collected: including tumor number, tumor size, Child Class score results, MELD score results and TNM stage results.
2.2 ELISA Assay
The study population of 163+8 people ate regularly for 3 days prior to blood sampling, fasting for 8 hours on the day before the blood draw, 5 ml of fasting venous blood was drawn on the following morning, within 2 h of the blood being drawn, the blood was taken to the laboratory, the serum is separated by centrifugation at 1000 rpm for 5 min at room temperature. Using the ENO1 (alpha-enolase, alpha-enolaSe) ELISA kit (abcam, UK) and AFP (alpha-fetoprotein) ELISA kits (Invitrogen, USA), serum ENO1 levels were measured by a multifunctional chemiluminescence instrument (Promega, USA) for each group of samples. The remaining blood specimens were centrifuged to obtain plasma and stored at -80 °C. ELISA assay steps.:
(1) Remove the ELISA plate and allow to stand for 20 minutes at room temperature before equilibrating the plate components.
(2) Dilute the standards in a 2-fold gradient using sample diluent and add 50 uL of diluted sample to each well using sample diluent. Take 10 uL of serum sample and mix with 40 uL of diluent and add to the assay wells.
(3) Seal the 96-well ELISA culture plate with air-seal plate film, shake and mix, centrifuge the plate transiently and incubate for 60 min in a 37°C thermostatic incubator for the reaction.
(4) Remove the plate, discard the liquid from the plate, pat the plate dry on stream filter paper, add 100 uL of wash buffer per well and leave for 1 min at room temperature, discard the wash buffer and drain the plate again, repeat 5 times.
(5) Add 50 uL each of substrate A and substrate B to the wells and incubate for 15 min at 37°C in an incubator protected from light, add 50 uL of termination solution to terminate the reaction, read the OD value of the wells at 450 nm using a fluorescent enzyme marker, set up 3 replicate wells for each sample.
2.3 RNA preparation and reverse transcription
Lysis and extraction of total RNA from tissues using TRIzol ® Reagent (Invitrogen,USA),verify RNA quality by electrophoresis of 0.3 μg RNA(1.3% agarose gel electrophoresis, 1× TAE buffer, 120 V, 20 min). The RNA was reverse transcribed into cDNA using the PrimeScript® RT reagent kit(Thermo,USA), the reverse transcribed RNA template was 500ng, The reverse transcription conditions are: 5 minutes at 25°C, 42°C for 60 minutes and 70°C for 5 minutes, the remaining RNA and cDNA were stored at -80°C.
2.4 Relative expression of ENO1 gene mRNA in hepatocellular carcinoma tissues by QRT-PCR
The cDNA was obtained from each group, the relative expression of ENO1 gene was measured by QRT-PCR using TransStart Tip Green qPCR SuperMix (Quan-Style Gold Biology, Beijing, China) on a LightCycler 480II quantification platform (Roche, USA). β-actin was used as the internal reference gene and the details of primer sequences used in the experiment were showed in Table1. The amount of cDNA template added within the reaction was 1 µL, Reaction conditions were 94°C for 30 seconds; 94°C reaction for 5 sec, 60°C for 30 sec, 72°C for 20 sec, 40 cycles of reaction; 65°C for 5 seconds. The Relative expression was calculated by the 2-ΔΔCt method.
Table 1. Primer sequences used for QRT-PCR
Name of gene
|
|
Primer Sequence (5’-3’)
|
Size of outputs
|
ENO1
|
Forward
|
CCTGTACCGCCACATCG
|
183 bp
|
Reverse
|
TGGTAAACCTCTGCTCCAAT
|
β-actin
|
Forward
|
CCACGGCTGCTTCCAGCTCC
|
131 bp
|
Reverse
|
GGACTCCATGCCCAGGAAGGAA
|
2.5 Western Blot detection of the relative expression of ENO1 protein in hepatocellular carcinoma tissues
Total protein was extracted from liver cancer tissue using a Total Protein Extraction Kit (KGI, Nanjing, China). Grinding of tissue specimens to powder using liquid nitrogen in a mortar,add 400µL of lysate, grind again to a powder, After the lysate powder has thawed to a liquid, the liquid is collected, centrifuge in a tube for 10 minutes under the condition of 4°C and 12,000 rpm, The supernatant is the protein extract. The concentration of the protein extract was determined using a BCA protein quantification kit (Nanjing KGI, China). 20 µg of protein specimens were taken, the proteins were separated in 10% SDS-PAGE electrophoresis. The proteins were transferred onto PVDF membranes (Millipore Corp, USA) using a semi-dry transfer machine (Biorad Trans-Blot SD, BIO RAD, USA). A Sealing fluid was made by dissolving 50 g of skimmed milk powder in 100 ml of 1 x TBST, The incubator was closed for 3h, then the sealing fluid was discarded,Wash 3 times with 1×TBST and add ENO1 primary antibody (monoclonal antibody, 1:1000 dilution, abcam, UK) and β-actin primary antibody (monoclonal antibody, 1:1000 dilution, abcam, UK) to the incubation cassette.,The incubation cassette was placed on a plate shaker at 50 rpm 4°C at room temperature and incubated overnight, 1 x TBST washed 5 times for 5 min each;After washing, IgG secondary antibody (1:5000 dilution, Proteintech, USA) was added to the incubation cassette,Incubation cassettes were placed on a plate shaker at 50 rpm for 2h and 1× TBST washed 5 times. 1:1 mixture of liquid A and liquid B of the ECL(WesternBright ECL,advansta,USA)was prepared as the assay solution, The bands were observed after exposure of the PVDF membrane using a multicolor fluorescent gel formation system(ChemiDoc MP Imaging System,Bio-Rad, USA). The protein bands were quantified using Image J software.
2.6 Statistical analysis
Data were collated and analyzed by using SPSS 23.0 (IBM, USA) software, All measurements are presented as mean ± standard deviation (x ± s), Comparative analysis of the significance of continuous measures and subgroup data using the T-test and one-way ANOVA methods; Analysis of the correlation between serum ENO1 levels and AFP levels using the bivariate Spearman correlation test; Analysis of the correlation between ENO1 levels and hepatitis B virus using curve regression; Analysis of the sensitivity and specificity of serum ENO1 in the diagnosis of hepatocellular carcinoma using the ROC curve (receiver operating characteristic curve); The survival curve was used to evaluate the relationship between serum ENO1 and survival of patients with hepatocellular carcinoma. All significant results were considered statistically significant at p<0.05 and highly significant at p<0.01.