Bioinformatics analysis
GEPIA [21] (http://gepia.cancer-pku.cn/detail.php) was used to analyse the expression of SH3PXD2A-AS1 in NSCLC and normal lung tissues and in lung adenocarcinoma (LUAD) and normal lung tissues in TCGA database. In addition, K-M analysis was performed to explore the effects of target genes on the survival rate in NSCLC and LUAD. Correlation analysis showed the correlation between the genes using the nonlog scale for calculation and the log-scale axis for visualization.
Clinical samples
NSCLC tissues were obtained from the Affiliated Hospital of Xuzhou Medical University. All specimens were pathologically confirmed as NSCLC, and the patients had not received radiotherapy or chemotherapy prior to surgery at the Affiliated Hospital of Xuzhou Medical University. After resection, the tumour and adjacent tissues were frozen in liquid nitrogen, and the specimens were immediately stored at −80°C. The patient studies were conducted in accordance with the Declaration of Helsinki. This study was conducted in compliance with the Declaration of Helsinki. The use of these specimens and data for research purposes was approved by the Ethics Committee of the Affiliated Hospital of Xuzhou Medical University.
Cell lines and cell culture
The immortalized normal human lung epithelial cell line BEAS-2B and the human NSCLC cell lines A549, H1299, H292 and H23 were purchased from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Science (Shanghai China). BEAS-2B, A549, H1299, H292 and H23 cells were cultured in DMEM medium and RPMI 1640 medium supplemented with 10% foetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin and incubated in a 37°C humidified incubator with 5% CO2.
Transient transfections and stable cell lines
PCDNA3.1-SH3PXD2A-AS1, PCDNA3.1-vector, shRNA-SH3PXD2A-AS1, and shRNA-ctrl vectors were transfected into NSCLC cells by Lipofectamine 2000 transfection reagent (Invitrogen, Shanghai, China). SiRNA-DHX9 was transfected into NSCLC cells by SilenFect reagent (Thermo Fisher Scientific, Inc., USA), while nonspecific siRNA was used as a negative control. All siRNAs were purchased from GenePharma Technology (Shanghai, China). SH3PXD2A-AS1 shRNA sequences were cloned into the vector pLko.1 at Age1/ECOR1 sites. SH3PXD2A-AS1 knockdown lentiviruses were generated by cotransfecting 293T cells with two packaging vectors, pMD2G and psPAX. The supernatants of cultured 293T cells were collected 48 h later, filtered through 0.45-mm filters (Millipore, Temecula, CA, USA) and concentrated using Amico Ultra centrifugal filters (Millipore 100 KD MWCO). H292 cells were infected with lentivirus for 48 h and then selected with 2 ng/ml puromycin for 2 weeks, with the medium refreshed every 3 days. The sequences are listed in below:
shSH3PXD2A-AS1#1-For: CCGGGCAGCTCAGGTGTATGTAAGGCTCGAGCCTTACATACACCTGAGCTGCTTTTTG;
shSH3PXD2A-AS1#1-Rev: AATTCAAAAAGCAGCTCAGGTGTATGTAAGGCTCGAGCCTTACATACACCTGAGCTGC;
shSH3PXD2A-AS1#2-For: CCGGGCACCAAGAGAGCCCTAAAGACTCGAGTCTTTAGGGCTCTCTTGGTGCTTTTTG;
shSH3PXD2A-AS1#2-Rev: AATTCAAAAAGCACCAAGAGAGCCCTAAAGACTCGAGTCTTTAGGGCTCTCTTGGTGC.
siDHX9#1: GAGCCAACUUGAAGGAUUATTUAAUCCUUCAAGUUGGCUCTT
siDHX9#2: CCUGGGAUGAUGCUAGAAUTTAUUCUAGCAUCAUCCCAGGTT
Cell proliferation and colony formation assays
Forty-eight hours after transfection, for CCK-8 analysis, ~4 × 103 cells were seeded in each well of 96-well plates, and CCK-8 solution was added 24, 48, 72, and 96 h after placing. Cells were incubated at 37°C for 2 h after 10 μl of CCK-8 solution was added. The absorbance at 450 nm was measured. For the colony formation assay, 1 × 103 cells were cultured in six-well plates at 37°C for 14 days; visible colonies were washed twice with PBS, fixed, and stained with 4% paraformaldehyde and crystal violet. The area of colony formation is measured by Image Pro Plus 6.0 and calculated with graphpad.
Cell cycle analysis
Cells were treated with 1 μg/ml aphidicolin at 48 hours after transfection. After 12 h, the cells were incubated in fresh medium containing 50 ng/ml nocodazole for 0, 3 or 6 h. Then, the cells were fixed with 70% cold ethanol at 4°C overnight and stained with 40 μg/ml propidium iodide in hypotonic fluorochrome buffer for 30 min. The samples were then analysed using a FACSCanto flow cytometer (BD Biosciences, San Jose, CA).
RNA extraction, reverse transcription-PCR and qRT-PCR
Total RNA from the lung tissue specimens and cell lines used in this study was extracted with TRIzol reagent (Vazyme Biotech, Nanjing, China). We synthesized cDNA by using HiScript Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech, Nanjing, China). Relative RNA levels determined by RT-qPCR were measured on a Roche LightCycler 480 by using UltraSYBR Mixture (CWBIO, Beijing, China). The primers used for quantitative RT-PCR analysis are listed below:
SH3PXD2A-AS1-For: CAGGAGTGTGCCACCATGCTTG;
SH3PXD2A-AS1-Rev: GGCAAGACTGGCTCATGAACTCTC;
SERPINB3-For: AGATTAACTCCTGGGTGGAAAG;
SERPINB3-Rev: CAATGTGGTATTGCTGCCAATA;
KIF20A-For: GAATGTGGAGACCCTTGTTCTA;
KIF20A-Rev: CCATCTCCTTCACAGTTAGGTT;
CENPF-For: TACAACGAGAGAGTAAGAACGC;
CENPF-Rev: CTACCTCCACTGACTTACTGTC;
FOXM1-For: GATCTGCGAGATTTTGGTACAC;
FOXM1-Rev: CTGCAGAAGAAAGAGGAGCTAT;
IFNB-1-For: TGGCTGGAATGAGACTATTGTT;
IFNB-1-Rev: GGTAATGCAGAATCCTCCCATA;
LGALS3-For: CAGACAATTTTTCGCTCCATGA;
LGALS3-Rev: TAGGCCCCAGGATAGGAAG;
TXNIP-For: GTTCAGAAGATCAGGCCTTCTA;
TXNIP-Rev: TCCAGGAACGCTAACATAGATC;
SAMD9-For: GCTTGAAAGTATCCATCGGTTC;
SAMD9-Rev: TCAACTGAAATGTTCCCGTTTC;
DHX9-For: TCCAACTGGAATCCTTGGAC;
DHX9-Rev: TTTTCCCACATCCAGTAGCC;
18S rRNA-For: GTAACCCGTTGAACCCCATT;
18S rRNA-Rev: CCATCCAATCGGTAGTAGCG.
Differential expression analysis and functional enrichment
For identification of differentially expressed genes (DEG) between two different samples, the expression level of each transcript was calculated according to the fragments per kilobase of exon per million mapped reads (FRKM) method. RSEM (http://deweylab.biostat.wisc.edu/rsem/) [22] was used to quantify gene abundances. The R statistical package software EdgeR (Empirical analysis of Digital Gene Expression in R, (http://www.bioconductor.org/packages/2.12/bioc/html/edgeR.html)) [23] was utilized for differential expression analysis. In addition, functional enrichment analysis, including GO and KEGG analyses, was performed to identify which DEGs were significantly enriched in GO terms and metabolic pathways with a Bonferroni-corrected P-value ≤0.05 compared with the whole-transcriptome background. GO functional enrichment and KEGG pathway analysis were carried out by Goatools (https://github.com/tanghaibao/Goatools) and KOBAS (http://kobas.cbi.pku.edu.cn/home.do) [24].
Western blotting analysis
Western blotting was carried out as previously reported. Briefly, protein extracts from cells or immunoprecipitation samples were prepared using detergent-containing lysis buffer. Total protein was subjected to SDS-PAGE and transferred to 0.45 μm PVDF membranes (Millipore). Antibodies against FOXM1 (Proteintech, 13147-1-AP, 1:1000, USA), CENPF (Affinity, DF2310, 1:1000, China), KIF20A (Affinity, DF8671, 1:2000 China), Cyclin B1 (Cell Signaling Technology, 12231, 1:1000, USA), HSPA5 (Proteintech, 115871-AP, 1:2000, USA), HSPA8 (Proteintech, 10654-1-AP, 1:2000, USA), DHX9 (Proteintech, 17721-1-AP, 1:2000, USA), and alpha tubulin (Proteintech, 66031-1-Ig, 1:100000, USA) were used for primary antibody incubation at 4 °C overnight.
RNA pulldown assay and mass spectrometry
RNA pulldown assays were carried out as described briefly: in vitro biotin-labelled RNAs (SH3PXD2A-AS1, its antisense RNA) were transcribed with Biotin RNA Labeling Mix (Promega Corporation, USA) and T7 RNA polymerase (Thermo Fisher Scientific, USA) treated with RNase inhibitor and purified with a Clean-up kit (Promega Corporation, USA). The biotinylated SH3PXD2A-AS1 probes were dissolved in binding and washing buffer and incubated with streptavidin agarose resin (Thermo Fisher Scientific, USA). Then, H292 cell lysates were incubated with probe-coated streptavidin beads, and the pulled-down proteins were run on SDS-PAGE gels. Then, the gels were stained with Coomassie Blue, and differentially abundant bands were cut out for mass spectrometry (Shanghai Applied Protein Technology Co., Ltd., China).
RNA immunoprecipitation
The RIP experiment was carried out with the EZ-Magna RIP Kit (Millipore) according to the manufacturer’s protocol using 5 mg of antibody. H292 cells were lysed in complete RIP lysis buffer, and the cell extract was incubated with protein A/g agarose beads conjugated with antibody DHX9 (17721-1-AP, Proteintech, USA) or control IgG for 2 hours at 4°C. Beads were washed and incubated with Proteinase K to remove proteins. Finally, purified RNA was subjected to quantitative RT-PCR analysis.
Animal experiments
Female BALB/cJGpt-Foxn1nu/Gpt mice (6-8 weeks old) were purchased from Nanjing GemPharmatech Technology Co., Ltd. (Nanjing, China). All animal experiments were approved by the Animal Care and Use Committee of Xuzhou Medical University. Groups of H292-shCtrl and H292-shSH3PXD2A-AS1 cells (5×106) were injected subcutaneously into the flanks of mice. Tumour volume (V) was monitored every 2/3 days by measuring the long axis (L) and the short axis (W) of xenograft tumours and calculated with the following formula: V = (L×W2)/2.
Immunohistochemistry (IHC)
IHC assays were implemented following a standard streptavidin-peroxidase (SP) method as previously reported [25], and heat-induced epitope retrieval (HIER) was performed with retrieval buffer (citrate, pH 6.0) prior to commencing the IHC staining protocol. For primary antibody incubation, anti-FOXM1 (sc-376471, santa cruz, USA ) antibody at a 1:100 dilution and anti-Ki67 (ab16667, Abcam, USA) antibodies at a 1:200 dilution were applied. The slide without primary antibody incubation served as a negative control.
Statistical analysis
Statistical analyses were carried out using SPSS 20.0 software (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 8. The Kaplan–Meier method and log-rank test were used to evaluate the correlation between SH3PXD2A-AS1 expression and NSCLC/LUAD patient survival. The unpaired t test was used to determine the statistical significance of differences between groups. Data are presented as the mean ± SD. P<0.05 was considered statistically significant.