2.1 Data download
RNA sequence data and patient information of 568 CRC cases and 44 normal tissue samples were downloaded from TCGA (https://portal.gdc.cancer.gov/). We also downloaded the RNA sequences and patient information of 177 colon cancer samples from the Gene Expression Omnibus (GEO; GSE17538; https://www.ncbi.nlm.nih.gov/geo/). Finally, we downloaded information on 2,782 CRGs from GeneCards (https://www.genecards.org) (until October 23, 2022).
2.2 Difference and enrichment analysis
DECRGs were identified using the Wilcoxon test with R package “limma” (|log2(fold change)| >2; FDR < 0.01). We conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses utilizing the R package “clusterProfiler” (p < 0.05) to evaluate biological functions and pathways.
2.3 Protein–protein interaction (PPI) and key modules
We analyzed the interaction between DECRGs proteins using STRING (https://cn.string-db.org/). Next, we constructed a PPI network using Cytoscape-3.9.0, and the molecular complexity detection (MCODE) of this software was used to identify more significant modules of the PPI network.
2.4 Identification of prognostic CRGs and construction of a prognostic model
We performed univariate Cox proportional hazards regression analysis and Kaplan–Meier analysis through R package “survival” to determine DECRGs with prognostic value (univariate Cox proportional hazards regression analysis: p < 0.01; Kaplan–Meier analysis: p < 0.05). Thereafter, least absolute shrinkage and selection operator analysis was performed to reduce overfitting. Finally, a multivariate Cox proportional hazards regression analysis was performed to construct a prognostic model.
2.5 Prognostic model validation and nomogram creation
The risk score is an index used to assess the prognosis of patients with CRC. In the model, the expression levels and regression coefficient of each gene were used to calculate the risk score of individual patients. Patients with CRC were categorized into high- and low-risk groups based on their median risk scores. Subsequently, Kaplan–Meier survival curves were plotted to assess whether the difference in survival between them was statistically significant. In addition, the receiver operating characteristic curve was drawn to assess the reliability of the model. The model exhibited good accuracy (i.e., area under the curve: ≥0.6 )(14). We used GSE17538 from the GEO as an external validation cohort to further verify CRGs with prognostic value. Age, sex, stage, and risk score were analyzed by Cox proportional hazards regression analysis to verify independent predictors of prognosis. Nomogram analysis was conducted using the R package “RMS” to calculate survivorship rates among patients with CRC.
2.6 Responses to immunotherapy, chemotherapy, and targeted therapy
The CIBERSORT algorithm was used to determine the degree of immune cell infiltration (15). We used the Tumor Immune Dysfunction and Exclusion (TIDE; http://tide.dfci.harvard.edu/) score to predict the response to immune checkpoint blockade in the two aforementioned risk groups (16). In addition, based on the Genomics of Drug Sensitivity in Cancer (https:/ /www.cancerrxgene.org), we used the packages “pRRophetic” and “ggplot2” to calculate the half maximal inhibitory concentration (IC50) of each group (p < 0.05).
2.7 CRC tissue collection
Tumor and normal tissues of 10 patients with CRC in the Affiliated Hospital of North Sichuan Medical College (Nanchong, China) were obtained. Patient information is shown in Table 1. Prior to surgery, patients did not receive chemotherapy, radiotherapy, or other anticancer treatment. All specimens were obtained within 20 min after surgery, transported in dry ice, and frozen at − 80°C.
Table 1
Patient number | Sex | Age (years) | TNM stage |
1 | Female | 75 | T2N1M0 |
2 | Male | 67 | T3N2M0 |
3 | Female | 65 | T3N0M0 |
4 | Male | 74 | T2N0M0 |
5 | Female | 52 | T4N0M0 |
6 | Female | 64 | T4aN0M0 |
7 | Male | 50 | T3N1M0 |
8 | Female | 74 | T2N0M0 |
9 | Male | 63 | T4N0M0 |
10 | Female | 84 | T3aN1M0 |
2.8 Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blotting analysis
Total RNA Extraction Kit (Solarbio, China) was used to extract total RNA from tissues or cells. Using HiScript® III RT SuperMix (Vazyme Biotech Co., China), the total RNA was reverse transcribed into cDNA. Finally, we performed qRT-PCR using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co.). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference. The target gene RNA levels were determined using the 2-ΔΔCt method. The primer sequences used for qRT-PCR are shown in Table 2.
Table 2
Primer sequences used for qRT-PCR
Primer | Sequence (5′–3′) |
GAPDH-Forward | GGAGTCCACTGGCGTCTTCA |
GAPDH-Reverse | GTCATGAGTCCTTCCACGATACC |
INHBB-Forward | CGGGTCCGCCTATACTTCTTC |
INHBB-Reverse | CGTAGGGCAGGAGTTTCAGG |
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; INHBB, inhibin subunit beta B; qRT-PCR, quantitative reverse transcription-polymerase chain reaction. |
We added 1% phenylmethylsulfonyl fluoride and radioimmunoprecipitation assay tissue/cell lysate (Solarbio) to cells or cut tissues, and allowed lysis to occur on ice for 20 min. Subsequently, lysed cells or tissues were centrifuged at 12,000 rpm for 15 min at 4°C. We measured protein concentration using a BCA concentration kit (Beyotime, China). Protein loading buffer (5×) (Beyotime) was added, and the samples were boiled for 10 minutes. We electrophoresed the prepared protein samples in a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, and transferred the proteins onto a Immobilon-P polyvinylidene difluoride membrane (Solarbio). Next, the membrane was blocked with a rapid blocking solution for 30 min and incubated with inhibin subunit beta B (INHBB; 1:1,000, FNab04320; FineTest) or GAPDH (1:1,000, ab181602; abcam) antibody overnight on a shaker at 4°C. Thereafter, the membrane was incubated with Goat Anti-Rabbit immunoglobulin G (IgG) (H + L) horseradish peroxidase (1:3,000, S0001; affinity) for 60 min at room temperature. After each antibody incubation, the membrane was washed thrice with tris-buffered saline with Tween 20 (10 min per wash). Finally, BeyoECL Star (Beyotime) was used to visualize the proteins.
2.9 INHBB in vitro experiment
The NCM460, HCT116, HCT15, DLD-1, SW480, and SW620 cell lines were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS) in an incubator at 37°C with 5% CO2. All cells were obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China).
The colon cancer cell lines HCT116 and SW480 were transfected with INHBB siRNA (siINHBB; IBSBIO, China) and Lipo8000™ Transfection Reagent (Beyotime) to knock down the expression of INHBB. Thereafter, the knockdown effectiveness of INHBB siRNA in these two cell lines was determined by western blotting.
The Ori Cell Counting Kit-8 (Oriscience Biotechnology Co., Ltd.) was used for the evaluation of cell proliferation. Cells were seeded in 96-well plates (1,500 cells per well). Cell Counting Kit-8 reagent was added to each well at 0, 24, 48, and 72 h, and the plates were placed in an incubator at 37°C with 5% CO2 for 120 min. Subsequently, the optical density was measured at 450 nm wavelength.
For the wound healing test, at 48 h after transfection, the cells were detached using trypsin and resuspended in six-well plates. When the cells reached confluency > 90%, wounds were performed using a pipette tip, and the serum-free medium was replaced. At 0 h and 48 h, the cells were observed under a microscope.
For the Transwell experiment, at 48 h after transfection, the cells were detached with trypsin, and cell suspension (10 µl) was used for cell counting. The migration experiment was conducted by resuspending 50,000 cells in FBS-free medium (200 µl), adding the suspension to a chamber, and placing the chamber in a 24-well plate with medium containing 10% FBS (500 µl) for further culture.For the invasion experiment, 60,000 cells were seeded in the upper chamber of the plate along with Matrigel (BD Bioscience). After 48 h, the chamber was removed, washed with phosphate-buffered saline (PBS), and fixed in 4% paraformaldehyde for 30 min. After washing with PBS, the chamber was placed in crystal violet staining solution for 30 min. After another wash with PBS, non-migrating cells and excess staining solution in the chamber were removed, the chamber was air-dried, and the remaining cells were observed under a microscope.
2.10 Statistical analysis
Data were analyzed using R-4.1.2, GraphPad Prism-8.0.1 (GraphPad Software, San Diego, CA, USA), and ImageJ-1.8.0.112 (Rawak Software Inc., Stuttgart, Germany).
2.11 Ethics statement
The experimental protocol was approved by the Ethics Committee of the Affiliated Hospital of North Sichuan Medical College (approval number: 2023ER069-1). Patients received information regarding this study and provided written informed consent prior to specimen collection.