Tungsten oxide, magnetic and Cu-doped magnetic nanoparticles mixtures with cyromazine as promising eco-friendly strategies to control of Spodoptera littoralis (Boisd.) (Lepidoptera: Noctuidae)

doi:10.21203/rs.3.rs-2818970/v1

Download PDF

Article

Tungsten oxide, magnetic and Cu-doped magnetic nanoparticles mixtures with cyromazine as promising eco-friendly strategies to control of Spodoptera littoralis (Boisd.) (Lepidoptera: Noctuidae)

https://doi.org/10.21203/rs.3.rs-2818970/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Excessive application of pesticides leads to contamination of the environment, which entails the necessity to seek solutions that employ substances which do not pose ecological hazards. So, the present study was conducted to explore the different effects of tungsten oxide (WRT), magnetic nanoparticles (MNPs), Cu-doped magnetic nanoparticles (MNP-Cu), the insecticide, cyromazine, and their binary mixtures against Spodoptera littoralis. The nanomaterials individually didn’t show any toxicity against S. littoralis stages. Cyromazine recorded the highest toxicity with LC₅₀ values of 58.7, 45.6, and 70.5 mgL^− 1 against eggs, 2nd, and 4th larvae, respectively. Nanoparticles showed an antagonistic effect which increased directly with concentrations. Cyromazine (100 mgL^− 1) + MNP-Cu (500 mgL^− 1) was the most repellent mixture for the 2nd and 4th larvae with feeding deterrence percent, 41.42% and 57.60%, respectively. Larval and pupal durations increased with increasing cyromazine and nanomaterial concentrations. Except for the cyromazine (25 mgL^− 1) + WRT (500 mgL^− 1) mixture, which recorded 27.3% adult emergence, no adult emergence was recorded by the 500 mgL^− 1 nanomaterial mixtures. Some malformations were also recorded for S. littoralis stages after being treated with tested materials. Cyromazine/MNP-Cu mixtures gave the highest significantly increased in the enzyme activity of glutathione S-transferase and α-esterase compared to the control. Regarding the results obtained by the Q-PCR, the insect immune response for the treatments indicated a high immune response in all the treated insects compared to the control. In conclusion, the nanomaterial-cyromazine mixtures may be recommended as promising alternatives for S. littoralis control.

Metal oxide nanoparticles

Magnetic nanoparticles

Lepidoptera

Detoxification enzymes

dd-PCR

Gene expression

The cotton leafworm, Spodoptera littoralis (Lepidoptera: Noctuidae), has a distribution role in regions of northern Africa, Middle East and Mediterranean. It is the most destructive pest of several crops; it infests more than 180 plant species¹ such as cotton, tomatoes, cabbage, cauliflower and other crucifers².

Chemical insecticides play the main role in S. littoralis control. Worldwide, about 2 million tons of pesticide is utilized. The global pesticide usage has been estimated by the year 2020 to increase to 3.5 million tons³. The excessive usage of conventional pesticides led to many environmental problems^{4, 5}, and development of insect resistance to many insecticides⁶. In order to reduce the use of the synthetic pesticides and their negative effects on the environment, researchers have been striving hard to developing new effective, environmentally friendly pest control agents^{7, 8}.

Nanotechnology can be used across all the other science fields such as chemistry, biology, physics, materials science, engineering⁹, and pest management through successful employed formulations of nanomaterial's-based pesticides^{10, 11}. Nanoparticles (NPs) with unique chemical properties influences the potential for pest control^12,13, becoming an alternative to chemical insecticides, because they are considered relatively safe for humans compared to synthetic insecticides^14,15. The potential of nanomaterials to be used in agriculture to promote plant growth, nutrition, and protection against abiotic stress factors, pathogen detection, and pesticide residue detection¹⁶.

Metal oxide nanoparticles, such as, zinc oxide, titanium dioxide^17,18, vanadium oxide, iron based oxides¹⁹, and tungsten oxide²⁰ are considered as; low cost materials, easy to produce and chemically stable. So, these nanomaterials are most candidates on various applications; including; water treatment²¹, antimicrobial²², sensors and much more.

In recent years, magnetic nanomaterials have been used as adsorbents for the removal of toxic metal ions, pesticides and antibiotics from contaminated wastewater and agricultural wastewater^{23, 24}, remediation of metal-contaminated soils and groundwater^{25, 26}, soil fertility promoters²⁷, biosensors^{28, 29}, seed priming agents³⁰, and smart plant treatment-delivery systems^{31, 32}. In addition, magnetite nanoparticles provide a solution that incorporates both characteristics. It is particularly effective in controlling the pest, specifically interfering with its larval development, and it does not cause environmental toxicity even at high concentrations³³.

The bioapplications based on magnetic nanoparticles have gotten special attention because they have prominent advantages over other materials in terms of cost and ease of manufacture, physical and chemical stability, biocompatibility, and environmental safety, as well as the ability to be tuned and functionalized for specific applications³⁴.

The insect growth disruptor, cyromazine (N-cyclopropyl-1,3,5-triazine-2,4,6-triamine), is highly efficacious against dipteran insects and some other insects by interfering with cuticle formation³⁵. Studies have shown that cyromazine decreases cuticle extensibility³⁶, exhibits remarkable toxic and inhibitory effects on S. littoralis growth³⁷.

Detoxification enzyme, Glutathione S-Transferases and α-esterase in insects are generally demonstrated as the enzymatic defense against foreign compounds and play significant roles in maintaining their normal physiological functions³⁸.

The present study was planned to investigate the different effects of tungsten oxide, magnetic nanoparticles and Cu-doped magnetic nanoparticles in compare with the insecticide, cyromazine, and their binary mixtures with cyromazine on the different stages of S. littoralis under laboratory conditions. In order to know the possibility of use and insert them as promising control agents within the integrated pest management (IPM) program for this destructive pest S. littoralis. Also, the study of insect immune responses against the examined nanomaterials using dd-PCR and Q-PCR to decrease the effect of the used insecticides was estimated. This is the first study to test the behavioral, biological, physiological and biochemical effects of the selected nanomaterials against S. littoralis.

Rearing of S. littoralis and the insecticide used

Experiments were conducted with S. littoralis taken from a stock that was reared in the laboratory away from any insecticidal contamination at the department of applied entomology and zoology, faculty of agriculture, Alexandria University on castor bean leaves, Ricinus communis L., under constant conditions of 27 ± 2° C and RH 65 ± 5%.

For the insecticide used in this study, cyromazine (Trigard® 75% WP), was purchased from Syngenta Agro Co. Switzerland.

Nanomaterials preparation

Tungsten oxide

0.5 M Na₂WO₄ solution was prepared as described by Elnouby et al.²⁰. Briefly, sodium tungstate dehydrate (Na₂WO₄·2H₂O, > 98%, Sisco, India) was dissolved in deionized water. A column was packed with 30 ml of ion-exchange resin (Rohm & Haas, France). This column was washed several times with water before using.10 mL of the (0.5 M Na₂WO₄) solution was loaded onto the column, to form yellowish and transparent tungstic acid (H₂WO₄) solution. The obtained solution was aged at room temperature for 24 h to produce precipitated tungsten oxide nanoparticles.

Magnetic nanoparticles

Magnetic nanoparticles were prepared via one put hydrothermal reaction.4 g of iron metal powder was mixed with 10 g of NaOH in 40 mL of water for 10 min. the mixture was transferred into a Teflon-lined steel autoclave container and aged in an oven at 120^oC for 24 h. The obtained powder was washed several times with distilled water and dried overnight at 60^oC.

Cu-doped magnetic nanoparticles

Cu-doped magnetic nanoparticles were prepared via one put hydrothermal reaction.4 g of iron metal powder was mixed with 10 g of NaOH in 40 mL of 0.1 M copper nitrate solution for 10 min. the mixture was transferred into a Teflon-lined steel autoclave container and aged in an oven at 120^oC for 24 h. The obtained powder was washed several times with distilled water and dried overnight at 60^oC.

Characterizations of nanomaterials

The obtained nanoparticles were characterized by several characterization tools. Scanning electron microscopy (SEM, JEOL, JSM-6360LA, Japan) was used to investigate the morphological structure of the obtained materials. Transmission electron microscopy (TEM, JEOL, JEM2100 plus, Japan) was used to explore the structural properties of the prepared materials. The crystallographic phases of the produced samples were determined by X-ray powder diffraction (XRD, Shimadzu-7000, Japan). A Bruker ALPHA spectrometer (Bruker Corporation, Rheinstetten, Germany) was used to perform the Fourier transform infrared (FTIR).

Toxicity bioassay tests

Tested concentrations

Cyromazine was tested at 10, 25, 50, 100 and 200 mgL^− 1

Nanomaterials were tested at 100, 200, 400, 500 and 1000 mgL^− 1

Concentrations of cyromazine at 25, 50 and 100 mgL^− 1 were individually mixed with 100 and 500 mgL^− 1 of each nanomaterial.

Ovicidal activity

Egg-masses of S. littoralis at 0–24 h ages were counted with the hand lens (10X), then dipped for 20 sec in different concentrations of the tested compounds, (distilled water to represent the control). Each treatment and control was replicated three times. Treated and untreated egg-masses were left to dry and kept at 27 ± 2°C, RH 65 ± 5%. The hatchability for each treatment was calculated after maximum hatch, using the microscopic examination.

Larvicidal activity

The toxicity of the tested compounds and mixtures was assessed against the 2nd and 4th larval instars of S. littoralis. Castor bean leaves, were dipped in the tested concentrations (distilled water for control) for 20 sec. then left to dry at room temperature. Each treatment and control was replicated 3 times (20 larvae per each). The mortality percentages were recorded after 96 h.

Antifeedant activity

The feeding inhibition (FI %) of the tested compounds was evaluated for 2nd and 4th larval instars of S. littoralis using leaf disc no choice bioassay method. FI% was calculated as follows: FI % = (C − T) / (C + T) × 100, where C: Consumption of control discs, T: Consumption of treated discs³⁹. The antifeedant activity was assessed for cyromazine alone and its mixtures with the nanomaterials. Fresh castor leaf discs were dipped in tested concentrations and allowed to dry for 30 min. at room temperature. The treated and control leaves were introduced for larvae to feed for 48h., three replicates were carried (20 larvae/ rep.) for each treatment. After 48h, the consumed weight of leaf disc was measured and antifeedant activity was calculated and data subjected to analysis of variance.

Biological aspects

The biological effects of cyromazine alone and its mixtures with the nanomaterials were assessed on S. littoralis using leaf dipping assay, three replicates were carried (50 larvae/ rep.) for each treatment. Larval duration (days), pupal duration (days), percentage pupation and percentage adult emergence were recorded; the larval, pupal and adult deformities were also spotted. The weight and length of 4th larval instars were estimated for control and treatment to investigate the growth inhibition effect of tested materials.

Biochemical assays

Sample preparation for enzymatic activity assay

The 4th larval instar was treated by cyromazine alone and its mixtures with the nanomaterials, and then the whole treated larvae were grinded in ice-cold 50mM sodium phosphate buffer (pH 7.5). The homogenates were centrifuged at 5000 rpm for 30 min at 4°C using Janetzki cooling centrifuge, and supernatant was used for biochemical assay. The protein content was estimated by the method of Lowry et al.⁴⁰, using bovine serum albumin as a standard protein to construct the standard curve.

Glutathione S-transferase (GST) assay

Activity of GST was carried using the method of Kao et al.⁴¹. 50 mM of 1-Chloro-2, 4-dinitrobenzene (CDNB) in 95% ethanol was added to 50 mM of GSH, and then 20 µL of homogenate (enzyme sample) were added. The change in absorbance was measured using Jenway 6300 spectrophotometer at 340 nm. The enzyme activity was calculated in terms of µmol CDNB conjugated/min/mg protein.

Alpha-esterase assay

The α-esterase activity was detected at 48 hrs post-treatment according to Van Asperen⁴²; Chen et al.⁴³ using α naphthyl acetate as substrate.

Differential display polymerase chain reaction (dd-PCR)

Total RNA extraction

The larva was grounded to a fine powder using liquid nitrogen from seven larva’s {(Treatments: control, T1, T2, T3, T4, T5, T6 and T7) and (Poll treatments: P1, P2, P3, P4, P5, P6 and P7)} as shown in table (1) and total RNA was extracted using TRIzol (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions and as described in our previous study ^{44, 45}. The obtained RNA was dissolved in diethyl dicarbonate-treated water then incubated with DNase for 1 h at 37°C to remove any DNA residues, and quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific).

Reverse transcription (cDNA synthesis)

With a total volume of 25 µL, the reaction mixture contained; RNA (3 µL), 10mM dNTPs (2.5 µL), 10× buffer with MgCl2 (2.5 µL), oligo (dT) primer (4 µL) and reverse transcriptase enzyme (Biolabs) (0.2 µL). The PCR was carried out using a SureCycler 8800 thermocycler (Agilent Technologies), at 37°C for 2 h and 65°C for 20 min.

dd-PCR

Six different primers were used to differentiate the genetic stability of the cDNA from fifteen larva samples (concentration = 50 mgL^− 1 from each treatment for each group and the pool reaction (three concentrations per treatment; 25, 50 and 100 mgL^− 1 together) was prepared for dd-PCR of each group, as shown in table (1), which were under our study. Sequences of primers were illustrated in (Table 2). The dd-PCR reaction with a total volume of 25 µL, the reaction mixture contained; 10× buffer (5 µL), 10 pmol primer (5 µL), 25mM MgCl2 (2.5 µL), 10mM dNTPs (2 µL), cDNA (1 µL) and Taq DNA polymerase (0.2 µL) (Promega). The dd-PCR was carried out using a SureCycler 8800 thermocycler (Agilent Technologies), with one cycle at 95°C for 3 min, 40 cycles (95°C for 45 sec, 30°C for 60 sec, 72°C for 1 min), final cycle 72°C for 5 min. The dd-PCR products were separated using 2% agarose gel electrophoresis with a DNA marker, photographed using a gel documentation system.

Q-PCR assay and data analysis

The effects of nanomaterials on larva interleukin genes were evaluated using qPCR. A different set of primers (Table 2) specific to IL-18, IL-1α, IL-1β, IL-1F, IL-19, and IL-8 genes were used in this study. The housekeeping gene β-actin (Table 2) was used as a reference gene to normalize the transcript expression levels. The treatments (control, T1, T2, T3, T4, T5, T6 and T7) of each group were prepared for qPCR analysis. Reactions of each sample were run in triplicate using Rotor-Gene 6000(QIAGEN, ABI System, Hilden, Germany) with the SYBR Green PCR Master Mix (Fermentas, Waltham, MA, USA)^{46, 47}.The amplification program and relative expression level of the target gene were accurately quantified and calculated, as described previously⁴⁸.

Statistical analysis

The LC₂₅ and LC₅₀ values were calculated using Biostat ver. (2.1) software for probit analysis⁴⁹. Data were compared by one-way analysis of variance (ANOVA) followed by Tukey’s studentized test when significant differences were found at p < 0.05⁵⁰.

Structural characterizations of nanomaterials

Tungsten oxide nanoparticles

TEM micrograph of the prepared tungsten oxide nanoparticles, it is clear the obtained nanoparticles are in uniform spherical shape (Fig. 1a). For XRD pattern of the prepared tungsten oxide nanoparticles. XRD pattern of the prepared tungsten oxide nanoparticles shows a single phase where all peaks was indexed to the orthorhombic WO3•H2O with a space group of Pmnb (62) and lattice parameters: a = 5.2380 Å, b = 10.7040Å, c = 5.1200 Å (ICDD Card No. 00-043-0679) as shown in Figure (1b). The FTIR spectra of the prepared tungsten oxide nanoparticles. The intense broad band at 3406 cm^− 1 revealed the stretching motion of (O-H), the medium narrow band at 1616 cm-1 is characteristic of in plane bending δ (H-O-H) of the water molecule. A very intense broad band in the region 902 − 621 cm^− 1 corresponding to different motion arising from W-O linkage. Therefore, the band at 902 cm^− 1 refers to the stretching of (W = Ot) (where Ot the terminal oxygen). The bands at 763 cm-1 and 694 cm^− 1 revealed the stretching (W-O) and the band at 713 cm^− 1 due to stretching (W-O-W) (Fig. 1c). The Raman spectra of the prepared tungsten oxide nanoparticles. The peaks at 75 and 128 cm^− 1 can be assigned to vibrational modes of block chains into the lattice of WO3 (; doi: 10.1063/5.0045190). The two bands observed at 261 and 322 cm^− 1 have been assigned to O–W–O bending modes of the bridging oxide (DOI 10.1007/s10854-014-2552-4). While, two other bands observed at 704 and 806 cm^− 1 are the corresponding stretching modes (Fig. 1d).

Magnetic nanoparticles

The TEM micrograph of the prepared MNP, it is clear the obtained nanoparticles are in polygon shape with a size distribution from 15 to 70 nm (Fig. 2a). The FTIR spectra of the MNP. The main peak at 567 cm-1 is referring to vibrational Fe–O which confirming the formation of iron oxide (Fe3O4). While, the peak at 1631 cm-1 is corresponding to O–H bending, confirmed the presence of hydroxyl groups on the MNP surfaces. The peak observed at 3437 cm^− 1 is ascribed to O-H starching indicating the presence of water molecules (Fig. 2b).

Cu-doped magnetic nanoparticles

TEM micrograph of Cu-doped magnetic iron oxide nanoparticles (Fig. 3), it is clearly noticeable that; the obtained product is composed of large crystals with a relatively uniform, square morphology; the wide range of crystal size explained the effect of Cu ions on the growth behavior of magnetic nanoparticles, comparing to pure magnetic nanoparticles (see Fig. 2).

The insecticidal effect of the tested materials

The use of nanomaterials with pesticidal activity or for the delivery of pesticides is an emerging technology. The toxicity of the tested materials against S. littoralis stages was evaluated under laboratory conditions and it was expressed in LC₅₀ and LC₂₅ values, Table (3). The tested nanomaterials individually didn’t show any toxicity against S. littoralis stages. Generally, the 2nd instar larvae were the more sensitive stage followed by egg then the 4th larvae. The insecticide, cyromazine showed the highest toxicity against the 2nd instar larvae with LC₅₀ value 45.6 mgL^− 1. Regarding the toxicity of the binary mixtures and effect of mixing cyromazine with the different nanomaterials, all mixtures recorded less toxicity than cyromazine alone with higher LC₅₀ values. The mixture cyromazine + MNP-Cu 100 mgL^− 1 recorded the highest toxicity with LC₅₀ value 47.8 mgL^− 1 for the 2nd instar larvae, while the lowest toxicity was recorded by the mixture cyromazine + WRT 500 mgL^− 1 with LC₅₀ value 84.7 mgL^− 1 for the 4th instar larvae. These results proved the antagonistic effect of the tested nanomaterials which increased by increasing the nanomaterial concentrations.

The behavioral effect of the tested materials

The behavioral, antifeedant effect of the insecticide, cyromazine and its binary mixtures with nanomaterials on the 2nd and 4th larvae of S. littoralis was evaluated under laboratory conditions. The results were illustrated in table (4) as feeding deterrence percent (FD %) values. Cyromazine (100 mgL^− 1) + MNP-Cu (500 mgL^− 1) was the most repellent mixture for the 2nd and 4th larvae with FD% 41.42% and 57.60%, respectively. Generally, the results referred that all mixtures recorded repulsive effects higher than cyromazine alone, which means that nanomaterials increased the repellent effect of cyromazine for 2nd and 4th S. littoralis larvae. The mixture, cyromazine + MNP were the second effective one as a repulsive agent. Unlike the toxicity effect, the results showed that the 4th instar larvae were most affected than the 2nd larvae. On the other hand, the lowest repulsive affects 11.70% for 2nd larvae and 14.48% for 4th larvae were recorded by the insecticide, cyromazine (25 mgL^− 1).

The biological aspects

The effects of tested materials and their mixtures on the biological aspects of S. littoralis were evaluated. The larval duration, pupal duration, pupation percent, adult emergence percent and some malformations were assessed, and the results were illustrated in figures (4–6). Survival of larvae was defined as the capacity of larvae to continue with metamorphosis up to the adult stage. The parameter used to estimate larval survival was the percentage of pupation and adult emergence after exposure. The results showed that the larval and pupal durations were significantly increased under all treatments compared with control. The longest larval and pupal periods were recorded under the treatment with the mixture cyromazine (100 mgL^− 1) + MNP-Cu (500 mgL^− 1) the survival periods were 23.5 and 15.6 days, respectively, followed by the mixtures of cyromazine + MNP. The larval and pupal durations increased exponentially with increasing the concentrations of cyromazine and nanomaterials. The percent of pupation and adult emergence were negatively affected by all treatments. Regarding the pupation percent, the mixtures of cyromazine (100 mgL^− 1) + MNP-Cu (500 mgL^− 1) caused the highest reduction in pupation percentages, 24.6%, followed with no significant different by the mixtures, cyromazine (100 mgL^− 1) + MNP (500 mgL^− 1) and cyromazine (100 mgL^− 1) + WRT (500 mgL^− 1). The adult emergence was highly affected by all treatments. No adult emergence was recorded under treatment by mixtures of 500 mgL^− 1 nanomaterials, except the mixture of cyromazine (25 mgL^− 1) + WRT (500 mgL^− 1) which recorded 27.3% of adult emergence. S. littoralis stages were suffered from the treatments, some malformations were reported (Fig. 6).

The 4th larval length and body weight of S. littoralis after affected by tested materials and their mixtures were further determined in Table 5 and Fig. 7. It was clear that, the larval length and body weight decreased progressively as the concentration of nanomaterials increased. Where, the 4th instar S. littoralis after treated with the MNP-Cu/cyromazine mixtures had significantly smaller length and lighter body weight as compared with the control and cyromazine treatments. The most effective mixture was cyromazine (100 mgL^− 1) + MNP-Cu (500 mgL^− 1), with the mean of larval length and body weight were 0.64 cm and 45.62 mg compared with 1.86 cm and 145.3 mg in the control.

Detoxification enzymes activities of S. littoralis 4th larvae

The effect of cyromazine and its mixtures with three nanomaterials on glutathione S-transferase and α-esterase enzyme activities were illustrated in Figure (8). The GST and α-esterase enzyme activities of S. littoralis from the cyromazine treatments were significantly higher than that of the mixtures with three tested nanomaterials. Mixing of cyromazine with nanomaterials decreased the excitatory effect of it on enzymatic activities. Cyromazine alone at 25, 50 and 100 mgL^− 1 were the highest induction, GST activity was 203.4, 205.5 and 210.4 µmol/min/mg protein, respectively, compared with 114.4 µmol/min/mg protein in the control. However, the mixture of cyromazine (100 mgL^− 1) with MNP-Cu (500 mgL^− 1) was 198.3 µmol/min/mg protein. The α-esterase activity of S. littoralis after treated with cyromazine alone at 100 mgL^− 1 was 523.7 µg α-naphthol/min/mg protein compared with 270.4 µg α-naphthol/min/mg protein in the control, followed by the mixtures of cyromazine + MNP-Cu.

Molecular Characterization

Differential display –PCR

Based on the up and down regulated genes DD-PCR the band pattern obtained by the primer rapid 2 showed that the treatment (T) samples were divided into three different groups in comparison with the control group. Both of samples T1 and T2 formed their own group, while samples T7 and T3 formed a separate group. Each of T4 and T5 samples formed its own group. In case of the samples P, samples were separated into four groups, the first group included samples P1, P2, P3, and P5. While each of the remaining three samples, P4, P6, and P7, was separated into its own group (Fig. 9A). Primer rapid 3 was able to differentiate the examined samples, divide T samples into three groups and P into four other groups. The first group included samples T1 and T2, the second group included T3 and T5, and the third group contained samples T6 and T7. In case of P samples, the first group included samples P1, 3, 4, and 5, while the other three, P 2, 6, and 7, were separated into three different groups (Fig. 9B).

In case of primer rapid 4, it was able to divide the treatments into four different groups compared to the control group. The first group included treatments T1, 2, 3, and 6. The other three treatments formed three separate groups. In the same context, the treatments P were divided into four separate groups, the first group contains P1 and 2, while P 3, 4 and 5 formed the second group and the remaining treatments P6 and P7 were separated into their own group (Fig. 9C). While primer rapid 6 grouped the T treatments into three groups compared with the control. The samples T1, 3 and 4 were located in one group, samples T2 and 7 were separated in another group, but sample T5 formed a unique group (Fig. 9D). In the case of P samples, the samples were grouped as follow; the first group included the two samples P1 and P3, and the second group included the samples P2 and P4, while the third and last group included the samples P5, P6, and P7 respectively (Fig. 9D).

However, the Primer rapid 8, succeeded to divide the T samples into three groups and for the first time the control group and T1 were collected in one group. While the T2 and T3 samples formed another group. The four treatments T4, 5, 6, and 7 each one of them was separated into its own group (Fig. 9E). On the other hand, the P treatments were divided into four groups; the first group being P2, 4, and 7, the second being P5 and 6. Yet, each P1 and P3 each were separated into separate groups (Fig. 9E). Like its counterpart, the primer rapid 10 was able to combine the control group with the T2 and T3 treatments in one group. Samples T4, 6, and 7 formed one group (Fig. 9F). T1 and T5 were each separated into their own group. In the case of P treatments, the Primer rapid 10 divided the examined samples into three groups; the first group included samples P2, 3, 4, and 5. The second group consisted of samples P6 and 7, while the sample B1 was separated into its own group (Fig. 9F).

In general, the DD-PCR results revealed that there were many up-regulated genes and also down regulated ones in the treated insects compared to the control. This is evident in insects treated with T2 and P6 which is amplified by primers 2, 3, 4, and 6. The induced genes detected in both primers 8 and 10 were few and appeared in T4 and P6 treatments. This effect has been shown to trigger some genes that may play a role in raising the insect's immunity rather than killing it. This was evident by the fact that the death rate was not mentioned when the larvae were treated with nanomaterials alone, but by mixing nanomaterials with the pesticide, the percentage of dead insects increased, though that percentage remained lower than the percentage obtained from the pesticide itself. It can be said that the nanomaterials tested in this paper did not have any toxic effect on the insects; they rather increased its immune system and reduced the percentage of toxicity of the insecticide on the insect in its different stages of growth, specifically in the stage of larva and pupa.

QRT-PCR analysis

By studying the gene expression of samples using interleukin 18, the results in the figure (10) showed that the gene expression was highest with seven treatments, followed by T5, T4, T6, and T2, respectively. The Gene Expression of samples T3 was relative or equal to the control sample, while the Gene expression was reduced to the lowest level with sample T1.The results obtained with the interleukin Alpha gene showed that the gene expression of all treatments was similar to the control except for sample 6, where the gene expression was very weak in comparison with the control or other samples.

In the case of interleukin and beta, the gene expression of the treatments was variable and did not have a specific pattern, it found that the gene expression of the control group was equal or close to the gene expression of treatments 2, 4, and 5, yet this expression was less with treatments 1, 3, and 7 when compared with the control or the gene expression of other treatments. On the other hand, sample 6 showed a higher gene expression than everyone else (Fig. 10).

On the other hand, the interleukin 1F, the results obtained showed that the gene expression of samples 6, 3, and 2 may approximate the gene expression of the control group, respectively. This gene expression has been reduced to the lowest level or may be absent with treatment No. 4. The gene expression of samples 5, 1, and 7 jumped to the highest level compared to the control group, respectively. In the case of interleukin 19, the results shown in samples 1 and 5 showed that the gene expression was close to or equal to the control sample. This expression was at the highest level for samples 2, 4, 3, and 7, respectively as shown in figure (10). Sample 6 had significantly lower gene expression when compared to the control group or other samples. In the case of interleukin 8, it was shown that the gene expression of all samples was high correlated to the control group, though the highest gene expression was found in samples 3, 2, 1, and 5, respectively (Fig. 10).

Nano-pesticides have shown a positive impact on the control of plant pests and diseases by delivering the active ingredient to the plant in a controlled way. This smart delivery provides sustainable solutions; reduces the amount, cost of fertilizers and pesticides for farmers⁵¹. In the present study, the tested nanomaterials alone have no toxicity against S. littoralis stages; these findings much agree with the findings which found that no significant genotoxicity or cytoxicity existed in magnetic nanoparticles (MNPs) treated water, where, MNPs have great potential in practical drinking water treatment to remove pathogenic bacteria⁵². On the other hand, some studies disagree with the present results which clarified that exposure to a highly concentrated dose of Ch-Fe3O4NPs leads to high larva mortality⁵³. Previous research works have reported acute intoxication of Drosophila melanogaster with iron (FeSO4) and proved to diminish fly survival and locomotor activity, including climbing capabilities⁵⁴.

The tested magnetic nanomaterials decreased the insecticidal effect of cyromazine and have antagonistic effect, this result agreed with Saeidi et al.⁵⁵, who approved the unique adsorption properties of the magnetic nanomaterials that due to different distributions of reactive surface sites and disordered surface regions that may explain the antagonistic effect of the tested nanomaterials. The dose concentration of Ch-Fe3O4NPs showed shortening of lifespan and decreased larval survival associated with the toxic effect against larvae and adults of D. melanogasterr⁵³. Abraham et al.³³ studied the effects of Fe3O4 nanoparticles during the development of the tephritid flies C. capitata and A. fraterculus. They found that only 40% of larvae feeder in medium 400 µg / ml Fe3O4 NPs was able to continue their life cycle, in contrast to 92% of the control.

We found larvae difficulties in advancing to the next stage of development, these was agreed with Chen et al.⁵⁶ who found that Drosophila uptake of NPs caused a significant decrease in the development and Drosophila female flies exhibit an adverse response, developmental delay, at the egg-pupae and pupae-adult transitions. Also, silver NPs significantly decreased the likelihood of lifespan (eggs to pupate) and reduced the percentage of adult emergences⁵⁷.

The present results revealed delaying in growth, decrease in larval size and some malformations caused by the MNPs treatment, this clearly correspond with the results which showed that short-term exposure of a concentration of Fe3O4 nanoparticles at 100 µg/ml is sufficient to cause lasting and harmful effects on the life cycle traits of C. capitata and A. fraterculus^58–62. Also, they reported delay in growth, abnormalities of wings, and the alteration and interruption of the life cycle. In D. melanogaster new born flies presented toxicity symptoms such as imperceptible movement and abnormal wing and bristle phenotypes after treatment with zinc oxide^{59, 61}.

Magnetite nanoparticles were produced and were tested to control populations of Tephritid fruit flies and the results showed that the magnetite nanoparticles disrupt life cycle of C. capitata and A. fraterculus by distressing the behavior and development of them altered the phenotype of larvae and pupae and disabled the ecdysis of pharate adult³³.

Kang et al.⁶³ used DD-PCR for studying the Trichoplusiani gene expression of the insect immune system both in larval and pupa instars infected with Enterobacter cloacae and they concluded that the DD-PCR have high potential to demonstrated the down and up regulated genes associated with the immune state of whole in compared with that genes involved in larval development. The same observation was reported by Seufi et al.⁶⁴, they postulated the challenged larvae of S. littoralis showed up regulation of different genes in different molecular sizes most of them are antimicrobial peptides (AMPs). In this study about 71 upregulated genes with different molecular weights were observed and more than 7 genes were down regulated. It means that either the used nanomaterials in this study in separate manner or mixed with the chemical pesticides affect the insect immune response positively 10 times compared with their negative effects. In another study, the Tribolium castaneum was treated with nanocarbon tubes coated with poly amido aminedendrimer generation 5 (PAMAM G = 5, cat.no. 536709) showed shutdown of specific genes but without no effect on the toxicity indicator gene. Nowicki et al.⁶⁵ used Neb‑colloostatin as eco-friendly pest control and they found that this type of hormone are capable to make immune disturbance for the treated insects and could help in insect control especially on Tenebriomolitor. Shahzad and Manzoor⁶⁶, postulated that nanomaterials especially nanoparticles that can affect the treated insects cuticle pigmentation and integrity and induce the insect immune responses and alter gene expression. The gene alteration resulted in altered protein, lipid, and carbohydrate metabolism along with cellular toxicity that impairs development and reproduction of the insect.

In this study we found that the used nanomaterials affected the gene expression and also the insect immune response but the toxicity of the used materials were weak in compared with the others chemical insecticides. Moreover, when the examined nanomaterials were mixed with the chemical insecticides insect deformation was observed and the mortality percentage was not high as expected. It can conclude that the used nano materials in this study render the toxicity of the chemical pesticides and generate individuals suffering malformation.

Regarding the results obtained by the Real Time PCR, the insects immune response for the treatments starting from T1 to T7 indicated high immune response in all the treated insects compared with the control except with theIL-1α the expression was steady in all examined samples, which means that our treatments haven`t any apoptotic effects on the treated insects⁶⁷. The high expression of IL-18 in treated insects means that these insects are capable to produce high amount of interferon-γ from T-cells and natural killer cells which means that the all the examined treatments in this study make the insect immune system strong not weak⁶⁸. The same observation with the Interlukin 1B but in case of IL-1F the high expression with the treatments T1, 5, 7, revealed that these three concentrations make inflammation for the insects but not killing it⁶⁹. The high expression of IL-19 with the treatments T2,3,4,7 means that these concentrations induce the anti-inflmatory regulating genes which recently formed but the T6 suppressed the anti-inflammatory effect which means that this treatment is more effective compared with the others⁷⁰. In case of the IL-8, it was observed that the gene expression profile confirm the results obtained by IL-19.

An emerging technology is the use of nanomaterials with pesticidal activity or for the delivery of pesticides. The use of tested nanomaterials as an additive compound to the insecticide aims to increase its pest control, not by increasing the insecticide toxicity but by interfering with behavioral and biological aspects of the pest. Generally, the insect immune response against the examined nanomaterials are capable to decrease the effect of the used insecticides and this response was increased when the insecticides was mixed with the examined nanomaterials in this study. Comprehensive studies about the toxicity of nanoparticles on non-target organisms should be undertaken to help develop control strategies in agriculture areas and minimize the environmental hazardous.

Acknowledgement

The authors are grateful to Ms. Marwa Samy (Plant Protection and Biomolecular Diagnosis Department, Arid Lands Cultivation Research Institute) for her help in the molecular investigation.

Funding: Not applicable.

Conflict of interest: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Availability of data and material: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Author Contributions: S.E.E, D.G.A, M.S.E, E.E.H. and H.S.H. idea and the design of the experiments; S.E.E. and H.S.H. toxicity bioassay tests, antifeedant activity, biological parameters, biochemical assay, data curation, formal analysis and writing-editing and revision of the manuscript; D.G.A. molecular investigation data analysis, writing-editing and revision of the manuscript; M.S.E. nanomaterials preparation and characterization; S.E.E, D.G.A, M.S.E, E.E.H and H.S.H. wrote the draft manuscript and revision of the manuscript; E.E.H. and A.AL-F. involved in conceptualization and investigation. All authors have read and agreed to the published version of the manuscript.

Arumugam, E., Muthusamy, B., Dhamodaran, K., Thangarasu, M., Kaliyamoorthy, K. & Kuppusamy, E. Pesticidal activity of Rivina humilis L. (Phytolaccaceae) against important agricultural polyphagous field pest, Spodoptera litura (Fab.) (Lepidoptera: Noctuidae). J Coast. Life. Med. 3, 389-394 (2015). DOI: 10.12980/JCLM.2.2014JCLM-2014-0059
Kumar, A., Negi, N., Haider, S. Z. & Negi, D. S. Composition and efficacy of Zanthoylum alatum essential oils and extracts against Spodoptera litura. Chemis. Natural Comp.50, 920-923 (2014). https://doi.org/10.1007/s10600-014-1118-2
Sharma, A., Kumar, V., Shahzad, B., Tanveer, M., Sidhu G. P. S., Handa N., et al. Worldwide pesticide usage and its impacts on ecosystem. SN Appl. Sci.1, 1446 (2019). https://doi.org/10.1007/s42452-019-14851.
Woodrow, J. E., Gibson, K. A. & Seiber, J. N. Pesticides and related toxicants in the atmosphere. Rev. Environ. Contam. Toxicol.247, 147-196 (2018). https://doi.org/10.1007/978-3-030-06231-6
Ippolito, A. & Fait, G. Pesticides in surface waters: from edge-of-field to global modelling. Curr. Opin. Environ. Sustain.36, 7884 (2019). https://doi.org/10.1016/j.cosust.2018. 10.023
Aydin, H. & Gürkan M. O. The efficacy of spinosad on different strains of Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae). Turk. J. Biol.30, 5-9 (2006).
Mahmood, I., Imadi, S. R., Shazadi, K., Gul, A. & Hakeem, K. R. Effects of pesticides on environment. In: Hakeem, K., Akhtar, M. & Abdullah, S. (eds) Plant, Soil and Microbes. Springer, Cham. p. 253-69 (2016). https://doi.org/10.1007/978-3-319-27455-3_13
Srivastava, A. K. & Kesavachandran, C. Health effects of pesticides: CRC Press (2019).
Bayda, S., Adeel, M., Tuccinardi, T., Cordani, M. & Rizzolio F. The history of nanoscience and nanotechnology: From chemical–physical applications to nanomedicine. Molecules25, 112 (2020). https://doi.org/10.3390/molecules 25010112
Rai, M. & Ingle, A. Role of nanotechnology in agriculture with special reference to management of insect pests. Appl. Microbiol. Biotechnol.94, 28793 (2012). https://doi.org/10.1007/s00253-012-3969-4
Benelli, G., Pavela, R., Maggi, F., Petrelli, R. & Nicoletti, M. Commentary: making green pesticides greener? The potential of plant products for nanosynthesis and pest control. J. Clust. Sci.28, 3–10 (2017). https://doi.org/10.1007/s10876-016-1131-7
Athanassiou, C. G., Kavallieratos, N. G., Benelli, G., Losic, D., Usha Rani, P. & Desneux, N. Nanoparticles for pest control: current status and future perspectives. J. Pest. Sci.91, 1–15 (2018). https://doi.org/10.1007/s10340-017-0898-0
Landa, P. Positive effects of metallic nanoparticles on plants: Overview of involved mechanisms. Plant Physiol. Biochem.161, 12–24 (2021). DOI: 10.1016/j.plaphy.2021.01.039
Keratum, A. Y., Abo, A. R. B., Ismail, A. A. & George, M. N. Impact of nanoparticle zinc oxide and aluminum oxide against rice weevil Sitophilus oryzae (Coleoptera: Curculionidae) under laboratory conditions. Egy. J. Plant Pro. Res.3, 30–38 (2015).
Salem, A. A., Hamzah, A. M. & El-Taweelah, N. M. Aluminum and zinc oxides nanoparticles as a new method for controlling the red flour beetles, Tribolium castaneum (Herbest) compared to malathion insecticide. JPPP6, 129–137 (2015). DOI: 10.21608/jppp.2015.53186
Khot, L. R., Sankaran, S., Maja, J. M., Ehsani, R. & Schuster, E. W. Applications of nanomaterials in agricultural production and crop protection: a review. Crop Prot.35, 64-70 (2012). https://doi.org/10.1016/j.cropro.2012.01.007
Elessawy, N. A., Gouda, M. H., Elnouby, M. S., Zahran, H. F., Hashim, A., Abd El-Latif, M. M. & Santos, D. M. F. Novel sodium alginate/ polyvinylpyrrolidone/ TiO₂ nanocomposite for efficient removal of cationic dye from aqueous solution. Appl. Sci.11, 9186 (2021). https://doi.org/10.3390/app11199186.
Senbill, H., Hassan, S. M. & Eldesouky, S. E. Acaricidal and biological activities of Titanium dioxide and Zinc oxide nanoparticles on the two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae) and their side effects on the predatory mite, Neoseiulus californicus (Acari: Phytoseiidae). J. Asia Pac. Entomol. 26, 102027 (2023). https://doi.org/10.1016/j.aspen.2022.102027
Elnouby, M. S., Taha, T. H., Abu-Saied, M. A., Saad, A. A, Yasser, S. M. M. & Mohamed, H. Green and chemically synthesized magnetic iron oxide nanoparticles-based chitosan composites: preparation, characterization, and future perspectives. J. Mater. Sci. Mater. Electron. 32, 10587–10599 (2021). https://doi.org/10.1007/s10854-021-05715-x
Elnouby, M. S., Kuruma, K., Nakamura, E., Abe, H., Suzuki, Y. & Naito, M. Facile synthesis of WO3•H2O square nanoplates via a mild aging of ion-exchanged precursor. Journal of the Ceramic Society of Japan121, 907-911 (2013). DOI 10.2109/jcersj2.121.907
Elsayed, E. M., Elnouby, M. S., Gouda, M. H, Elessawy, N. A. & Santos, D. M. F. Effect of the morphology of tungsten oxide embedded in sodium alginate/polyvinylpyrrolidone composite beads on the photocatalytic degradation of methylene blue dye solution. Mater.13, 1905 (2020). https://doi.org/10.3390/ma13081905
Moustafa, M., Alamri, S., Elnouby, M., Taha, T., Abu-Saied, M. A., Shati, A., Al-Kahtani, M. & Alrumman, S. Hydrothermal preparation of TiO2-Ag nanoparticles and its antimicrobial performance against human pathogenic microbial cells in water. Biocell.42, 93-97 (2018). DOI: 10.32604/biocell.2018.07014
Wang, T., Ai, S., Zhou, Y., Luo, Z., Dai, C., Yang, Y., Zhang, J., Huang, H., Luo, S. & Luo, L. Adsorption of agricultural wastewater contaminated with antibiotics, pesticides and toxic metals by functionalized magnetic nanoparticles. J. Environ. Chem. Eng.6, 6468–6478 (2018). https://doi.org/10.1016/j.jece.2018.10.014
Almomani, F., Bhosale, R., Khraisheh, M., Kumar, A. & Almomani, T. Heavy metal ions removal from industrial wastewater using magnetic nanoparticles (MNP). Appl. Surf. Sci.506, 144924 (2020). https://doi.org/10.1016/j.apsusc.2019.144924
Baragaño, D., Alonso, J., Gallego, J. R., Lobo, M. C. & Gil-Díaz, M. Magnetite nanoparticles for the remediation of soils co-contaminated with As and PAHs. Chem. Eng. J.399, 125809 (2020). https://doi.org/10.1016/j.cej.2020.125809
Dhaliwal, S. S., Singh, J., Taneja, P. K. & Mandal, A. Remediation techniques for removal of heavy metals from the soil contaminated through different Sources: a review. Environ. Sci. Pollut. Res.27, 1319–1333 (2019). https://doi.org/10.1007/s11356-019-06967-1
Ditta, A., Mehmood, S., Imtiaz, M., Rizwan, M. S. & Islam, I. Soil fertility and nutrient management with the help of nanotechnology. Nanomater. Agric. For. Appl.2020, 273–287 (2020). https://doi.org/10.1016/B978-0-12-817852-2.00011-1
Griesche, C. & Baeumner, A. J. Biosensors to support sustainable agriculture and food safety. TrAC Trends Anal. Chem.128, 115906 (2020). https://doi.org/10.1016/j.trac.2020.115906
Lu, Y., Yang, Q. & Wu, J. Recent advances in biosensor-integrated enrichment methods for preconcentrating and detecting the low-abundant analytes in agriculture and food samples. TrAC Trends Anal. Chem.128, 115914 (2020). https://doi.org/10.1016/j.trac.2020.115914
Dutta, P. Seed priming: New vistas and contemporary perspectives. In advances in seed priming; Rakshit A, Singh HB Eds.; Springer: Singapore, pp. 3–22 (2018). https://doi.org/10.1007/978-981-13-0032-5_1
Arosio, P. Applications and properties of magnetic nanoparticles. Nanomater.11, 1297 (2021). DOI: 10.3390/nano11051297
Spanos, A., Athanasiou, K., Ioannou, A., Fotopoulos, V. & Krasia-Christoforou, T. Functionalized magnetic nanomaterials in agricultural applications. Nanomater.11, 3106 (2021). DOI: 10.3390/nano11113106
Abraham, A. L. B., de Ávila, M. R., Torres, R. & Diz, V. Magnetite nanoparticles as a promising non-contaminant method to control populations of fruit flies (Diptera: Tephritidae). J. Appl. Biotechnol. Bioeng. 8, 112‒117 (2021). DOI: 10.15406/jabb.2021.08.00262
Wei, W., Zhaohui, W., Taekyung, Y., Changzhong, J. & Woo-Sik, K. Recent progress on magnetic iron oxide nanoparticles: synthesis, surface functional strategies and biomedical applications. Sci. Technol. Adv. Mate16, 023501 (2015). https://doi.org/10.1088/1468-6996/16/2/023501
Pener, M. P. & Dhadialla, T. S. An overview of insect growth disruptors; Applied aspects. Eds Dhadialla, T. S. Advances in Insect Physiology (Elsevier, Oxford) 43, 1–162 (2012). https://doi.org/10.1007/s00253-012-3969-4
Reynolds, S. E. & Blakey, J. K. Cyromazine causes decreased cuticle extensibility in larvae of the tobacco hornworm, Manduca sexta. Pestic. Biochem. Physiol.35, 251–258 (1989). https://doi.org/10.1016/0048-3575(89)90086-2
Tanani, M., Hamadah, Kh., Ghoneim, K., Basiouny, A. & Waheeb, H. Toxicity and bioefficacy of Cyromazine on growth and development of the Cotton leafworm Spodoptera littoralis (Lepidoptera: Noctuidae). Int. J. Res. Studies in Zool1, 1-15 (2015).
Li, X-Z. & Liu, Y-H. Diet influences the detoxification enzyme activity of Bactrocera tau (Walker) (Diptera: Tephritidae). Acta Entomol. Sin.50, 989-995 (2007). http://www.insect.org.cn/EN/Y2007/V50/I10/989
Hussein, H. S. & Eldesouky, S. E. Insecticidal, behavioral and biological effects of chlorantraniliprole and chlorfluazuron on cotton leafworm, Spodoptera littoralis. Pak. J. Biol. Sci. 22, 372-382 (2019). DOI: 10.3923/pjbs.2019.372.382
Lowry, O. H., Rosebrough, N. J., Farrand, A. L. & Randall, R. J. Protein measurement with the folin phenol reagent. J. Biol. Chem.193, 265-275 (1951). PMID: 14907713.
Kao, C. H., Hung, C. F. & Sun, C. N. Parathion and methyl parathion resistance in diamondback moth (Lepidoptera: Plutellidae) larvae. J. Econ. Entomol.82, 1299-1304 (1989). https://doi.org/10.1093/jee/82.5.1299
Van Asperen, K. A. Study of housefly esterases by means of sensitive colorimetric method. J. Insect Physiol.8, 401-414 (1962). https://doi.org/10.1016/0022-1910(62)90074-4
Chen, R., Guo, L. & Dang, H. Gene cloning, expression and characterization of a cold-adapted lipase from psychrophilic deep-sea bacterium Psychrobacter sp. C18. World J. Microbiol. Biotechnol.27, 431-441 (2011). https://doi.org/10.1007/s11274-010-0475-7
Aseel, D. G., Mostafa, Y., Riad, S. A. & Hafez, E. E. Improvement of nitrogen use efficiency in maize using molecular and physiological approaches. Symbiosis 78, 263–274 (2019a).
Rashad, Y. M., Aseel, D. G. & Hafez, E. E. Antifungal potential and defense gene induction in maize against Rhizoctonia root rot by seed extract of Ammivisnaga (L.) Lam. Phytopathol. Mediterr.57, 73-88 (2018). https://doi.org/10.14601/Phytopathol_Mediterr-21366
Aseel, D. G., Rashad, Y. M. & Hammad, S. M. Arbuscular mycorrhizal fungi trigger transcriptional expression of flavonoid and chlorogenic acid biosynthetic pathways genes in tomato against tomato mosaic virus. Sci. Rep.9, 1–10 (2019b). https://doi.org/10.1038/s41598-019-46281-x
Rashad, Y., Aseel, D., Hammad, S. & Elkelish, A. Rhizophagus irregularis and Rhizoctonia solani differentially elicit systemic transcriptional expression of polyphenol biosynthetic pathways genes in sunflower. Biomolecules10, 379 (2020). DOI: 10.3390/biom10030379
Schmittgen, T. D. & Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc.3, 1101–1108 (2008). https://doi.org/10.1038/nprot.2008.73
Biostat ver. (2.1) software for probit analysis (2011).
SAS (Statistical analysis System) SAS users guide statistics. SAS institute, Cary, North Carolina, U.S.A (1997).
Chhipa, H., Chowdhary, K. & Kaushik, N. Artificial production of agarwood oil in Aquilariasp. by fungi: a review. Phytochem. Rev.16, 835–860 (2017). https://doi.org/10.1007/s11101-017-9492-6
Xu, Y., Chengcai Li, C., Zhu, X., Huang, W. E. & Zhang, D. Application of magnetic nanoparticles in drinking water purification. Environ. Eng. Manag. J.13, 2023-2029 (2014). DOI: 10.30638/eemj.2014.224
Vela, D., Rondal, J., Cárdenas, S., Gutiérrez-Coronado, J., Jara, E., Debut, A. & Pilaquinga, F. Assessment of the toxic effects of chitosan-coated magnetite nanoparticles on Drosophila melanogaster. Am. J. Appl. Sci.17, 204-213 (2020). https://doi.org/10.3844/ajassp.2020.204.213
Jimenez–Del–Rio, M., Guzman–Martinez, C. & Velez–Pardo, C. The effects of polyphenols on survival and locomotor activity in Drosophila melanogaster exposed to iron and paraquat. Neurochem. Res.35, 227–238 (2010). DOI: 10.1007/s11064-009-0046-1
Saeidi, M., Naeimi, A. & Komeili, A. Magnetite nanoparticles coated with methoxy polyethylene glycol as an efficient adsorbent of diazinon pesticide from water. Adv. Environ. Technol.1, 25-31 (2016). http://dx.doi.org/10.22104/aet.2016.350
Chen, H., Wang, B., Feng, W., Du, W., Ouyang, H., Chai, Z. & Bi, X. Oral magnetite nanoparticles disturb the development of Drosophila melanogaster from oogenesis to adult emergence. Nanotoxicology9, 302-312 (2015). DOI: 10.3109/17435390.2014.929189
Gorth, D. J., Rand, D. M. & Webster, T. J. Silver nanoparticle toxicity in Drosophila: size does matter. Int. J. Nanomedicine6, 343–350 (2011). DOI: 10.2147/IJN.S16881
Ovrusky, S. M. & Schliserman, P. Biological control of tephritid fruit flies in Argentina: Historical review, current status, and future trends for developing a parasitoid mass–release program. Insects3, 870–888 (2012). https://doi.org/10.3390/insects3030870
Anand, A. S., Prasad, D. N., Singh, S. B. & Kohli, E. Chronic exposure of zinc oxide nanoparticles causes deviant phenotype in Drosophila melanogaster. J. Hazard Mater.327, 180–186 (2017). DOI: 10.1016/j.jhazmat.2016.12.040
Barik, B. K. & Mishra, M. Nanoparticles as a potential teratogen: a lesson learnt from fruit fly. Nanotoxicology13, 258–284 (2018). DOI: 10.1080/17435390.2018.1530393
Dan, P., Sundararajan, V., Ganeshkumar, H., Gnanabharathi, B., et al. Evaluation of hydroxyapatite nanoparticles–induced in vivo toxicity in Drosophila melanogaster. Appl. Surf. Sci.484, 568–577 (2019). https://doi.org/10.1016/j.apsusc.2019.04.120
Basso, A. & Sonvico, A. Identification and in situ hybridization to mitotic chromosomes of a molecular marker linked to maleness in Anastrepha fraterculus (Wied.). J. appl. Biotechnol. Bioeng.7, 237–240 (2020). DOI: 10.15406/jabb.2020.07.00239
Kang, D., Liu, G., Gunne, H. & Steiner, H. PCR differential display of immune gene expression in Trichoplusiani. Insect Biochem. Mol. Biol.26, 177-184(1996). DOI: 10.1016/0965-1748(95)00080-1
Seufi, A. M., Hafez, E. E. & Galal, F. H. Identification, phylogenetic analysis and expression profile of an anionic insect defense in gene, with antibacterial activity, from bacterial challenged cotton leafworm, Spodoptera littoralis. BMC Mol. Biol.12, 47 (2011). https://doi.org/10.1186/1471-2199-12-47
Nowicki, P., Kuczer, M., Schroeder, G. & Czarniewska, E. Disruption of insect immunity using analogs of the pleiotropic insect peptide hormone Neb-colloostatin: a nanotech approach for pest control II. Sci Rep11, 9459 (2021). https://doi.org/10.1038/s41598-021-87878-5
Shahzad, K. & Manzoor, F. Nanoformulations and their mode of action in insects: a review of biological interactions. Drug Chem. Toxicol.44, 1-11 (2021). DOI: 10.1080/01480545.2018.1525393
Dinarello, C. A., Novick, D., Kim, S. & Kaplanski, G. Interleukin-18 and IL-18 binding protein. Front. Immunol. 4, 289 (2013). https://doi.org/10.3389/fimmu.2013.00289.
Bankers-Fulbright, J. L., Kalli, K. R. & McKean, D. J. Interleukin-1 signal transduction. Life Sci.59, 61–83 (1996). DOI: 10.1016/0024-3205(96)00135-X.
March, C. J., Mosley, B., Larsen, A., Cerretti, D. P., Braedt, G., Price, V., Gillis, S., Henney, C. S., Kronheim, S. R., Grabstein, K., et al. Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature315, 641-7 (1985). DOI: 10.1038/315641a0
Gallagher, G. Interleukin-19: Multiple roles in immune regulation and disease. Cytokine Growth Factor Rev. 21, 345–352 (2010). DOI:10.1016/j.cytogfr.2010.08.005

Table 1.Treatments, nonmaterial concentrations and abbreviation of treatments used in this study

No.	Treatments	Nanomaterial Conc. (mgL^-1)	Cyromazine Conc.(mgL^-1)	Abbreviation of treatments	Abbreviation of poll treatments	dd-PCR	Q-PCR
1	Control	-	-	C	-	+	+
2	Cyromazine	-	25	-	P1	-	-
3			50	T1		+	+
4			100	-		-	-
5	Cyromazine + WRT	100	25	-	P2	-	-
6			50	T2		+	+
7			100	-		-	-
8		500	25	-	P3	-	-
9			50	T3		+	+
10			100	-		-	-
11	Cyromazine + MNP	100	25	-	P4	-	-
12			50	T4		+	+
13			100	-		-	-
14		500	25	-	P5	-	-
15			50	T5		+	+
16			100	-		-	-
17	Cyromazine + MNP-Cu	100	25	-	P6	-	-
18			50	T6		+	+
19			100	-		-	-
20		500	25	-	P7	-	-
21			50	T7		+	+
22			100	-		-	-

WRT: tungsten oxide nanoparticles. MNP: magnetic nanoparticles. MNP-Cu: Cu-doped magnetic nanoparticles.

Table 2. Primer sequences of dd-PCR and Q-PCR used in this study.

No.	dd-PCR		Q-PCR
No.	Primer Names	Primers Sequences 5ˋ-----3`	Gene names	Primers Sequences 5ˋ-----3`
1	RAPD2	ATGCCCCTGT	IL-18F IL-18R	ATCGCTTCCTCTCGCAACAA CTTCTACTGGTTCAGCAGCCATCT
2	RAPD3	CAGGGGACGA	IL-1α F IL-1α R	CGCCAATGACTCAGAGGAAGA AGGGCGTCATTCAGGATGAA
3	RAPD4	CCTTGACGCA	IL-1βF IL-1β R	AATCTGTACCTGTCCTGCGTGTT TGGGTAATTTTTGGGATCTACACTCT
4	RAPD6	AAAGCTGCGG	IL-1F8 IL-1R8	ACCACCATCTGATCTATCTTGTTCTCT GTGCTGCCTCCCGTTGTG
5	RAPD8	ACCTGAACGG	IL-19F IL-19R	AGGAAGGGCCGTCTATCAATC GAACTGCCACAAGGTTCTGAC
6	RAPD10	GAGAGCCAAC	IL-8F IL-8R	CTTGGCAGCCTTCCTGATTT TTCTTTAGCACTCCTTGGCAAAA
6	RAPD10	GAGAGCCAAC	β-actin F β-actin R	ATGCCATTCTCCGTCTTGACTTG GAGTTGTATGTAGTCTCGTGGATT

Table 3. Insecticidal activity of WRT, MNP, MNP-Cu, cyromazine and the binary mixtures of nanomaterials with cyromazine against different stages of S. littoralis after 96 hr post-treatment.

Treatment	Nano. conc. (mgL^-1)	Stage	LC₅₀^a (mgL^-1)	95 % CL^b	LC₂₅^c (mgL^-1)	Slope ± SE^d	(χ²)^e
WRT	-	Egg	˃ 1000	-	-	-	-
		2^nd larval instar	˃ 1000	-	-	-	-
		4^th larval instar	˃ 1000	-	-	-	-
MNP	-	Egg	˃ 1000	-	-	-	-
		2^nd larval instar	˃ 1000	-	-	-	-
		4^th larval instar	˃ 1000	-	-	-	-
MNP-Cu	-	Egg	˃ 1000	-	-	-	-
		2^nd larval instar	˃ 1000	-	-	-	-
		4^th larval instar	˃ 1000	-	-	-	-
Cyromazine	-	Egg	58.7	47.4 – 73.2	16.9	1.25 ± 0.13	0.22
		2^nd larval instar	45.6	36.5 – 56.7	18.2	1.68 ± 0.19	0.12
		4^th larval instar	70.5	55.7 – 90.6	26.0	1.57 ± 0.18	0.09
Cyromazine + WRT	100	Egg	63.8	52.7 – 78.2	23.2	1.41 ± 0.15	0.17
		2^nd larval instar	52.4	41.2 – 67.0	18.7	1.50 ± 0.19	0.15
		4^th larval instar	82.3	66.2 - 105.4	33.6	1.74 ± 0.21	0.56
	500	Egg	65.4	54.9 – 79.1	24.6	1.59 ± 0.15	0.50
		2^nd larval instar	59.2	46.7 – 76.0	21.3	1.52 ± 0.18	0.25
		4^th larval instar	84.7	65.8 – 116.1	28.4	1.42 ± 0.19	0.46
Cyromazine + MNP	100	Egg	61.5	50.4 – 74.6	21.1	1.46 ± 0.14	0.38
		2^nd larval instar	49.2	38.8 – 62.4	18.4	1.56 ± 0.19	0.16
		4^th larval instar	77.8	61.3 – 102.9	27.8	1.50 ± 0.18	0.41
	500	Egg	64.3	53.5 – 77.4	23.7	1.56 ± 0.15	0.39
		2^nd larval instar	56.6	44.5 – 72.9	19.8	1.49 ± 0.18	0.05
		4^th larval instar	80.2	64.0 – 104.0	30.9	1.63 ± 0.20	0.10
Cyromazine + MNP-Cu	100	Egg	59.6	50.3 – 70.8	22.4	1.59 ± 0.14	0.30
		2^nd larval instar	47.8	38.6 – 59.0	19.8	1.76 ± 0.21	0.19
		4^th larval instar	75.0	60.2 – 96.4	29.1	1.64 ± 0.20	0.28
	500	Egg	62.4	52.3 – 73.8	22.8	1.55 ± 0.15	0.23
		2^nd larval instar	50.3	39.6 – 63.4	18.4	1.52 ± 0.17	0.77
		4^th larval instar	78.9	63.3 - 102.5	30.2	1.62 ± 0.20	0.25

WRT: tungsten oxide nanoparticles. MNP: magnetic nanoparticles. MNP-Cu: Cu-doped magnetic nanoparticles. ^aThe concentration causing 50% mortality. ^bConfidence limits. ^cThe concentration causing 25% mortality. ^dSlope of the concentration-mortality regression line ± standard error. ^eChi square value.

Table 4. Antifeedant activity of cyromazine alone and its mixtures with WRT, MNP and MNP-Cu at 100 and 500 mgL^-1concentrations on the 2^ndand 4^th larval instars of S. littoralis after 48 hr from the feeding on treated leaves.

Treatment	Nano. Conc. (mgL^-1)	Cyromazine Conc. (mgL^-1)	2^nd instar larvae		4^th instar larvae
Treatment	Nano. Conc. (mgL^-1)	Cyromazine Conc. (mgL^-1)	Mean weight of leaf consumed (g)	FD (%)^*	Mean weight of leaf consumed (g)	FD (%)
Control	-	-	0.816	-	1.182	-
Cyromazine	-	25	0.645	11.70^o	0.883	14.48^m
		50	0.636	12.40^o	0.865	15.49^lm
		100	0.624	13.32^no	0.852	16.22^klm
Cyromazine + WRT	100	25	0.600	15.25^mn	0.840	16.91^klm
		50	0.590	16.10^lm	0.836	17.15^kl
		100	0.578	17.07^klm	0.820	18.08^k
	500	25	0.572	17.58^kl	0.798	19.39^j
		50	0.556	18.95^jk	0.775	20.80^ij
		100	0.545	19.92^ij	0.760	21.73^hij
Cyromazine + MNP	100	25	0.524	21.79^hi	0.746	22.61^ghi
		50	0.510	22.08^gh	0.735	23.32^gh
		100	0.498	24.20^fg	0.705	25.28^g
	500	25	0.479	26.02^ef	0.676	27.24^f
		50	0.466	27.38^de	0.645	29.39^ef
		100	0.454	28.50^d	0.616	31.48^e
Cyromazine+ MNP-Cu	100	25	0.435	30.46^d	0.577	34.40^d
		50	0.408	33.33^c	0.543	37.04^c
		100	0.386	35.86^b	0.524	38.57^bc
	500	25	0.378	36.68^b	0.345	54.81^a
		50	0.352	39.73^a	0.332	56.14^a
		100	0.338	41.42^a	0.318	57.60^a

WRT: tungsten oxide nanoparticles. MNP: magnetic nanoparticles. MNP-Cu: Cu-doped magnetic. ^*Feeding deterrence percent (FD %) = [(C − T) / (C + T)] × 100, where C is the consumption of the control discs and T is the consumption of the treated discs³⁹. Means followed by different lowercase letters within the same column denote significant difference at P <0.05.

Table 5. Effect of cyromazine and its mixtures with WRT, MNP and MNP-Cu on the larval length and body weight of 4^th instar larvae of S. littoralis.

Treatment	Nanomaterials Conc. (mgL^-1)	Cyromazine Conc. (mgL^-1)	Larval length (cm) ± SE*	Larval body weight (mg) ± SE
Control	-	-	1.86^a ± 0.012	145.03^a ± 1.66
Cyromazine	-	25	0.95^b ± 0.018	68.60^b ± 1.70
		50	0.93^bc ± 0.015	67.43^bc ± 2.08
		100	0.92^bcd ± 0.020	66.17^bcd ± 1.96
Cyromazine + WRT	(100 mgL^-1)	25	0.90^bcde ± 0.026	65.13^bcde ± 1.91
		50	0.89^cdef ± 0.023	64.40^bcde ± 2.12
		100	0.87^defg ± 0.020	63.27^cdef ± 1.31
	(500 mgL^-1)	25	0.85^efgh ± 0.017	62.76^def± 0.88
		50	0.84^fgh ± 0.018	61.10^efg ± 1.28
		100	0.82^ghi ± 0.015	59.36^fgh ± 1.04
Cyromazine + MNP	(100 mgL^-1)	25	0.81^hij ± 0.017	58.20^ghi ± 1.27
		50	0.80^hijk ± 0.026	56.63^hij ± 1.52
		100	0.78^ijkl ± 0.015	55.30^hij ± 1.70
	(500 mgL^-1)	25	0.76^jklm ± 0.017	54.26^ijk ± 1.09
		50	0.75^klm ± 0.022	53.47^jkl ± 1.44
		100	0.73l^mn ± 0.015	52.70^jklm ± 1.15
Cyromazine + MNP-Cu	(100 mgL^-1)	25	0.72^mno ± 0.018	50.83^klmn ± 0.75
		50	0.71^mno ± 0.023	49.36^lmno ± 1.85
		100	0.69^nop ± 0.017	48.50^mno ± 1.76
	(500 mgL^-1)	25	0.67^op ± 0.021	46.97^no ± 1.82
		50	0.65^p ± 0.017	46.23^o ± 1.74
		100	0.64^p ± 0.018	45.62^o ± 1.40

WRT: tungsten oxide nanoparticles. MNP: magnetic nanoparticles. MNP-Cu: Cu-doped magnetic Means followed by different lowercase letters within the same column denote significant difference at P<0.05. SE^*means standard error.

No competing interests reported.

graphicalabstract.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Tungsten oxide, magnetic and Cu-doped magnetic nanoparticles mixtures with cyromazine as promising eco-friendly strategies to control of Spodoptera littoralis (Boisd.) (Lepidoptera: Noctuidae)

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Nanomaterials preparation

Tungsten oxide

Magnetic nanoparticles

Cu-doped magnetic nanoparticles

Characterizations of nanomaterials

Toxicity bioassay tests

Ovicidal activity

Larvicidal activity

Antifeedant activity

Biological aspects

Biochemical assays

Sample preparation for enzymatic activity assay

Alpha-esterase assay

Differential display polymerase chain reaction (dd-PCR)

Total RNA extraction

Reverse transcription (cDNA synthesis)

dd-PCR

Q-PCR assay and data analysis

Statistical analysis

Results

Structural characterizations of nanomaterials

Tungsten oxide nanoparticles

Magnetic nanoparticles

Cu-doped magnetic nanoparticles

The insecticidal effect of the tested materials

The behavioral effect of the tested materials

The biological aspects

Molecular Characterization

Differential display –PCR

QRT-PCR analysis

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1