Four families with X-linked intellectual disability affected males: Novel deleterious variants and clinical features with the review of literature

doi:10.21203/rs.3.rs-2833503/v1

Download PDF

Research Article

Four families with X-linked intellectual disability affected males: Novel deleterious variants and clinical features with the review of literature

https://doi.org/10.21203/rs.3.rs-2833503/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 11 Oct, 2023

Read the published version in BMC Medical Genomics →

You are reading this latest preprint version

Introduction:

Intellectual disability (ID) is a heterogeneous condition affecting brain development, function, and/or structure. The X-linked mode of inheritance of ID (X-linked intellectual disability; XLID) has a prevalence of 1.7 out of 1000 in males. Exome sequencing technology has revolutionized the process of disease-causing gene discovery in XLID. Nevertheless, so many of them still remain with unknown etiology. This study investigated four families with severe XLID to identify deleterious variants for possible diagnostics and prevention aims.

Methods

Nine male patients, their siblings, and the parents of four pedigrees were included in this study. The patients were studied genetically for Fragile X syndrome, followed by whole exome sequencing and analysis of intellectual disability-related genes variants. Sanger sequencing, co-segregation analysis, structural modeling, and in silico analysis were done to verify the causative variants. In addition, we collected data from previous studies to compare and situate our work in relation to existing knowledge.

Results

We found three novel deleterious variants in three different genes, including ZDHHC9 (p. Leu189Pro), ATP2B3 (p. Asp847Glu), and GLRA2 (p. Arg350Cys) with new clinical features and a reported pathogenic variant in the L1CAM (p. Glu309Lys) gene related to new clinical findings.

Conclusion

The current study's findings expand the existing knowledge of variants of the genes implicated in XLID and extend the spectrum of phenotypes associated with the related conditions. The data has implications for genetic diagnosis and counseling.

XLID

L1CAM

ZDHHC9

ATP2B3

GLRA2

Intellectual disability

Exome sequencing

Iran

Intellectual disability (ID) is a heterogeneous condition affecting brain development, function, and/or structure. ID has a prevalence of about 2–3% of global populations, and males exceed females by 20–30%, likely due to an enrichment of genes on the X-chromosome that are required for the neurodevelopment and the genetic imbalances in X-chromosomes. The prevalence of X-linked ID (XLID) in males has been estimated at 1.7 cases in 1000 births. Thus, it is the most frequent cause of ID in males [1, 2]. XLID can be grouped into syndromic and non-syndromic forms. At least 209 different XLID disorders have been described, including 143 syndromic forms. Fragile X syndrome is the most common and most studied XLID syndrome. In the recent decade, remarkable progress has been made in identifying new causative genes and understanding the underlying mechanisms in over 100 XLID conditions [3]. Next-generation sequencing (NGS) is the most powerful technique for identifying new variants and genes in XLID conditions [4]. Despite all advances, more than 80 XLID conditions remain without a molecular diagnosis [5], and identifying disease-causing genes and variants is necessary for precise diagnosis. It would expand the existing knowledge of XLID and the spectrum of phenotypes associated with the identified variants. A vast majority of known causative genes are highly expressed in the brain and involved in different biological functions and pathways [6]. Four of XLID- associated genes involved in neuronal signaling pathways are L1CAM, ZDHHC9, GLRA2, and ATP2B3. The L1CAM gene encodes a neural cell adhesion molecule involved in cell adhesion dynamics and the generation of transmembrane signals at tyrosine kinase receptors. It is critical in multiple processes during brain development, including neuronal migration, axonal growth and fasciculation, and synaptogenesis [7]. The ZDHHC9 gene encodes a palmitoyl-transferase that add palmitate onto various protein substrates. It is implicated in neurological disorders [8]. The GLRA2 gene encodes a glycine receptor responsible for mediating glycine's inhibitory effects in neurons and is widely distributed throughout the CNS, particularly within the hippocampus, spinal cord, and brain stem [9]. The ATP2B3 gene encodes an ATP-driven calcium ion pump involved in the maintenance of basal intracellular calcium levels at the presynaptic terminals [10]. Clinical and genetic studies on these genes are few and more studies have led to precise diagnoses of the conditions and the design of new therapeutic approaches; the knowledge could also be helpful in genetic counseling, prenatal diagnosis (PND), pre-implementation genetic diagnosis (PGD), and predict prognosis of the disease.

The present study was launched on four families suspected with XLID. Whole exome sequencing (WES) and clinical evidence were used to identify pathogenic variants in the subjects. Furthermore, precise phenotyping and literature review were performed.

Family recruitment and DNA extraction

The research was performed according to the Declaration of Helsinki and was approved by the Ethics Committee of the Medical University of Isfahan, Isfahan, Iran (Ethics code: IR.MUI.MED.REC.1400.042). Four families with two or more ID patients suspected with the X-linked mode of inheritance were ascertained from the Isfahan and, Sistan & Balouchestan provinces of Iran. Through genetic counseling, medical history was taken, and pedigrees were drawn by the “Progeny” software (Progeny Software, LLC). Peripheral blood was withdrawn after taking informed written consent from the legal guardians. DNA was extracted using the DNSol Miniprep Kit (provided by ROJETECHNOLOGIES company, Tehran, Iran).

Molecular studies, whole-exome sequencing, and variant prioritization

All probands were tested for FMR1 CGG repeats to rule out Fragile X syndrome. It was done using DevinerÒ Fragile X (FMR1 Gene) Carrier Screen Kit (provided by KEYSAR Company, Tehran, Iran).

WES was done by 3Billion Inc. Exome capture was performed using xGen Exome Research Panel v2 (Integrated DNA Technologies, Coralville, Iowa, USA), and sequencing was performed using NovaSeq 6000 (Illumina, San Diego, CA, USA). Then, the bases of the sequences were generated and uniquely aligned to the Genome Reference Consortium Human Build 37 (GRCh37) and revised Cambridge Reference Sequence (rCRS) of the mitochondrial genome. The variant interpretation was performed using the EVIDENCE software [11] to prioritize variants and interpreted based on the guideline recommended by the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) [12] in the context of the patient’s phenotypes. Relevant family history and previous clinical test results were provided through genetic counseling. Only variants deemed to be clinically significant and relevant to the patient's primary clinical indications at the time of variant interpretation were considered.

Sanger sequencing and Co-segregation analysis

All candidate variants were confirmed using Sanger sequencing, and co-segregation analysis was performed on affected and unaffected members of the families. Specific primers for the variants were designed using the Primer3 online tool (Primer3web, version 4.1.0) and validated by online tools such as Primer-BLAST [13], MFEprimer3.1[14] and SNPCheck (gene tools, SNPCheck V3). The used primers sequences include L1CAM (F: CCACGCCCACCATCAAATG, R: CGGTGACATAGTACGCATGC (product size of 177bp)), ZDHHC9 (F: CTGGGTGGGGAATTGTGTTG, R: GTGCTCATTTCTAACCTGTCCT (product size of 250bp)), GLRA2 (F: CTCTCTCTCTCAGGTCTCCTATG, R: TCTGAACTGAGGGGCAATCAT (product size of 186 bp)), ATP2B3 (F: CAACTTCACCAGCATCGTCAA, R: ACCCTCACTCTCACAATCTG (product size of 213 bp)).

Structural modeling and in silico analysis

The I-TASSER Web Server was used for modeling the three-dimensional structure of the proteins, and the best one in terms of quality was selected for the following analysis. PyMOL (Version 2.2.3, Schrödinger, LLC.) software was used for visualization, mutagenesis, and structural analysis. Also, multiple stability prediction tools such as SAAFEC-SEQ (http://compbio.clemson.edu/SAAFEC-SEQ/), mCSM (http://structure.bioc.cam.ac.uk/mcsm), INPS-3D (https://inpsmd.biocomp.unibo.it/inpsSuite), and I-Mutant2.0 (http://gpcr.biocomp.unibo.it/~emidio/I-Mutant2.0/old/I-Mutant2.0_Details.html) were used for evaluating the effects of the variants on the protein stabilities.

We used the Genome Aggregation Database (gnomAD v2.1.1) for population allele frequency analysis. The potential pathogenicity of the variants was assessed using the following prediction tools: FATHMM & FATHMM-MKL (Functional Analysis through Hidden Markov Models (v2.3), http://fathmm.biocompute.org.uk), LIST-S2 (https://list-s2.msl.ubc.ca/?session=28AB3E5B08FD16AF971162581885ACC2), M-CAP (Mendelian Clinically Applicable Pathogenicity, http://bejerano.stanford.edu/mcap/), Mutation assessor (http://mutationassessor.org/), MutPred (http://mutpred.mutdb.org/), PROVEAN (PROVEAN scores (v1.1)), SIFT (Scale-Invariant Feature Transform, https://sift.bii.a-star.edu.sg/)& SIFT4G, MutationTaster (https://www.mutationtaster.org/), BayesDel (addAF and noAF)(https://fengbj-laboratory.org/BayesDel/BayesDel.html), MetaLR (e!Ensembl https://useast.ensembl.org/index.html), MetaRNN (http://www.liulab.science/metarnn.html), REVEL (Rare Exome Variant Ensemble Learner, e!Ensembl https://useast.ensembl.org/index.html) , DEOGEN2 (http://deogen2.mutaframe.com/).

Clinical evaluations

Nine severe ID male patients belonging to four families were recruited from the Isfahan and, Sistan & Balouchestan provinces of Iran. Pedigree analysis suggested the possibility of XLID (Figure 1). The ages of patients ranged from 3 to 40 years at the time of recruitment, and they mainly exhibited severe ID with or without dysmorphic features congenitally. Clinical descriptions of patients are as follows:

Family I: The proband (Figure 1-I-A-P(III-3)) is a 14-year-old boy with severe ID who was prenatally diagnosed with hydrocephalus and underwent ventriculoperitoneal shun surgery ten days after birth. He had lower limb muscle weakness in infancy and delayed milestones. He started walking at five years old through occupational therapy but had no history of difficulties with upper limbs. He suffered from delayed speech and language development and showed poor unclear speech (aphasia). He experienced multiple spasms, such as persistent neck and back muscle spasms that lasted about ten days (spastic paraplegia) and persistent stomach spasms since childhood. He has behavior problems, including; aggressive behavior, stressfulness, agitation, and self-injurious behavior (He shows bumps on finger joints due to chewing fingers). He has some dysmorphic features such as a long thin face, strabismus (hypertropia type), low-set ears, wide nasal bone, and a severe toe deformity that was corrected by surgery a couple of years ago. The mother had an abortion history of a male fetus in the 5^th month of pregnancy for an unknown reason. He has two normal sisters without any medical issues. There are family histories of brain hemangioblastoma and severe ID in the maternal uncle (34 years old).

Family II: The proband (Figure 1-II-A-P(III-3)) is a three-year-old boy with severe ID, neurodevelopmental delay, delayed milestones with no speech, and no walking. The Magnetic Resonance Imaging (MRI) showed corpus callosum agenesis and colpocephaly. His parents were not consanguineous. He has an elder brother (8 years old) with a similar condition who suffered from severe ID, developmental delay (delayed milestone; i.e., he started walking at six years old), and speech disorder, and also shows vision problems, persistent leg pains, and muscle weakness beginning from six years of age. They have a sister with no medical issues. There is a family history of severe ID, speech disorder, and vision problems in the maternal uncle, who is 40 years old and a product of consanguineous marriage.

Family III: The proband (Figure 1-III-A-P(III-5)) is a 17-year-old boy with severe ID and aggressive behavior. He had speech and developmental delays diagnosed as pervasive developmental disorders (PDD) by a pediatric neurologist due to behavioral and communication problems. He also shows some facial features such as a broad face, prominent lips, low-set-ears, broad eyebrows, long eyelashes, prominent eyelashes, and a broad nasal tip. The electroencephalogram (EEG) reports were normal. His parents are not consanguineous. He has an elder brother (29 years old) with similar conditions, including; severe ID and developmental and speech delay. However, there are some differences between these affected brothers in phenotype; the elder brother did not show aggressive behavior, is incommunicative and silent, shows a milder phenotype in facial features, and also experienced epilepsy in childhood, which was controlled by medicine. The mother had a history of abortion in the 3rd month of pregnancy. They had no positive family history of intellectual disability.

Family IV: The proband (Figure 1-IV-A-P(IV-1)) is a four-year-old boy with severe ID, neurodevelopmental delay, delayed milestones with no speech, no walking, and hearing impairment. He shows behavioral problems such as restlessness and crying. He shows dysmorphic facial features such as strabismus, congenital hypotrichosis, and low eyebrow. He had seizures at the age of two that is controlled by medicine. There are some bumps on the skull in touch examinations with no medical diagnosis. EEG showed a severe abnormality, and Auditory Brainstem Response (ABR) showed moderate hearing loss in the right ear and moderate to severe hearing loss in the left ear. Metabolic panel screening was negative. Brain computerized tomography (CT) scan showed coronal and axial thin sections in petrous bone, normal appearance of both external auditory canal, middle ear cavity, ossicular chain, and inner ear structure, no bony erosion, and normal scan of petrous bones. His parents are relatives. He has a family history of severe ID and seizures in the maternal uncle (19 years old), who has a movement disability in the left limbs. He also has facial features such as; a long face, prominent ear, low eyebrow, and broad nasal tip.

Molecular and Sequencing findings

Screening for CGG trinucleotide repeats in the five ′ untranslated regions of the FMR1 gene showed normal ranges of repeat numbers (less than 55). All of the probands were selected for WES, and after WES data analysis, deleterious candidate variants were revealed on the X chromosome; L1CAM (ChrX:153135577:C>T(GRCh37), NM_001278116.2, c.925G>A, p.Glu309Lys), ZDHHC9 (ChrX:128948693:A>G(GRCh37), NM_016032.4, c.566T>C, p.Leu189Pro), GLRA2(ChrX:14708949:C>T(GRCh37), NM_002063.4, c.1048C>T, p.Arg350Cys) and ATP2B3 (ChrX:152823677:C>G(GRCh37), NM_001001344.2, c.2541C>G, p.Asp847Glu). Sanger sequencing validated candidate variants. In Family I, the variant was found to be co-segregated with the conditions in the proband, and his maternal uncle and mother and one of the proband’s sisters showed carrier status (Figure 1-I-B). In Family II and IV, the variants were segregated in affected members, while the mothers were heterozygote carriers (Figure 1-II-B and Figure 1-IV-B). In Family III, two brothers were hemizygous for the candidate variant, the mother was heterozygote, and the candidate variant was not seen in healthy males in the pedigree (Figure 1-III-B).

In silico analysis findings

Structural modeling

As a result of the p.Leu189Pro variant in the ZDHHC9 gene, which was found in Family II, a leucine amino acid (Figure 2-B) at position 189 of ZDHHC9 protein (Figure 2-A) has been substituted with a proline (Figure 2-C). Figure 2-A shows that this residue is located in an alpha helix secondary structure.

The variant p.Arg350Cys in the GLRA2 protein (Figure 2-D) in Family III leads to the replacement of arginine 350, which forms salt bridges and hydrogen bonds with glutamic acid 347 and salt bridges with arginine 343 (Figure 2-E), to the cysteine, and all the mentioned bonds are lost (Figure 2-F).

Finally, in the ATP2B3 protein (Figure 2-G), because of the p.Asp847Glu variant in Family IV, an aspartic acid 847 (Figure 2-H), which is an acidic residue, is replaced with another acidic residue (glutamic acid) (Figure 2-I). As shown in Figure (2-H), aspartic acid 847 forms a salt bridge and a hydrogen bond with arginine 911. Due to its smaller side chain, the glutamic acid replacement results in the loss of the abovementioned salt bridge and hydrogen bond (Figure 2-I).

Stability prediction

The stability tools predicted all three novel candidate variants to be destabilizing/decreased stability (Table 1).

Allele frequency

The NM_016032.4(ZDHHC9): c.566T>C and NM_001001344.2(ATP2B3), c.2541C>G were not observed in the gnomAD database. The NM_002063.4(GLRA2):c.1048C>T variant was observed at an extremely low frequency in the gnomAD database (total allele frequency: 0.002%).

Pathogenicity score

The NM_016032.4(ZDHHC9): c.566T>C variant has a damaging effect based on FATHMM-MKL (score=0.9845), LIST-S2 (score=0.9765), M-CAP (score=0.3318), Mutation assessor (score=4.115), MutPred (score=0.749), PROVEAN (score=4.25), SIFT (score= -0.003), SIFT4G (score=-0.031), MutationTaster (score= 1).

Pathogenicity score of the NM_002063.4(GLRA2):c.1048C>T variant using in silico prediction tools such as BayesDel addAF (score=0.2), BayesDel noAF (score=0.17), MetaLR (score=0.7), MetaRNN (score=0.68), REVEL (score=0.69), DEOGEN2 (score=0.77), FATHMM (score=1.68), FATHMM-MKL (score=0.85), LIST-S2 (score=0.99), M-CAP(score=0.38), MutationTaster (score=1), PROVEAN (score=4.16, 4.08,4.28), SIFT (score=-0.01, -0.003), SIFT4G (score=-0.005, -0.009) showed this variant as damaging.

The pathogenicity of the NM_001001344.2(ATP2B3), c.2541C>G variant had been analyzed by BayesDel addAF (score=0.4), BayesDel noAF (score=0.33), MetaLR (score=0.93), MetaRNN (score=0.85), REVEL (score=0.84), FATHMM (score=4.49), FATHMM-MKL (score=0.95), LIST-S2 (score=0.96), M-CAP (score=0.45), MutationTaster (score=0.9999), PROVEAN (score=3.71) and SIFT (score=-0.001), which suggested it’s the damaging effect.

Variant interpretation

According to the results of the current study, the NM_016032.4(ZDHHC9): c.566T>C and the NM_001001344.2(ATP2B3), c.2541C>G variants met the criteria of PM1 (located in a mutational hot spot and/or critical and well-established
functional domain without benign variation), PM2 (absent from controls or at extremely low frequency if recessive in Exome Sequencing Project, 1000 Genomes or ExAC), PP1 (co-segregation with the disease in multiple affected family members in a gene
definitively known to cause the disease) and PP3 (Multiple lines of computational evidence support a deleterious effect on
the gene or gene product) and the NM_002063.4(GLRA2):c.1048C>T variant had evidence for PM1, PM2, PM5 (novel missense change at an amino acid residue where a different
missense change determined to be pathogenic has been seen before), PP1 and PP3 criteria. Therefore, all three novel candidate variants were classified as “likely pathogenic” based on ACMG guideline of variant interpretation[12].

X-linked intellectual disability (XLID) is characterized by extensive genetic heterogeneity; to date, variants in more than 100 genes on the X-chromosome are known to be associated with XLID [15]. Here, we investigated four families with XLID conditions using WES and identified novel deleterious variants in three genes with variable clinical findings and a reported deleterious variant with new clinical features.

In Family I, a previously known pathogenic variant (NM_001278116.2: c.925G>A, p. Glu309Lys) in the L1CAM gene was identified. The L1CAM gene is located near the telomere of the long arm of the X chromosome at Xq28. It consists of 29 exons and encodes the L1 Cell Adhesion Molecule (L1CAM protein), a neuronal cell adhesion molecule that plays an essential role in nervous system development, including neuronal migration and differentiation. It is an axonal glycoprotein belonging to the immunoglobulin supergene family and contains thirteen distinct domains; six immunoglobulins and five fibronectin III-like (FnIII) domains at the extracellular surface, one single-pass transmembrane domain, and one short cytoplasmic domain [7]. To date, 240 different L1CAM mutations have been reported, scattered over the entire gene without hot spots, and more than 200 are disease-causing mutations [16]. Mutations in this gene are associated with eight phenotypic conditions and, interestingly, can lead to a clinical spectrum called L1 syndrome that varies not only between families but sometimes also within families. Mutations in the L1CAM gene are numerous, and a genotype-phenotype correlation has been described; 1) truncating mutations in the extracellular domain of the L1CAM gene lead to a severe phenotype, (2) mutations in the cytoplasmic domain of L1CAM gene causes a milder phenotype than extracellular domain, and (3) missense mutations in extracellular domain affecting the surface of a domain cause a milder phenotype than those are in the core of the domain [17]. The p.Glu309Lys (c.925G>A) variant in this gene identified in the present study is related to the phenotypic features in two relative patients ( Figure 1-I-A). It is located in exon 8 and affects the Ig-like C2-type 3 ectodomain of the L1CAM protein [7]. The identified p.Glu309Lys (c.925G>A) variant in the L1CAM gene was previously described [18, 19], related to MASA (Mental retardation, Aphasia, Shuffling gait, Adducted thumbs) syndrome and is confirming genotype-phenotype correlation in which milder phenotypes are related to the missense mutation in the extracellular domain of the L1CAM gene. However, there are phenotypic differences between the previous studies on this deleterious variant and the current study on patients diagnosed with this variant (Table 2). We encountered some new clinical features in the present study, including; behavior problems such as self-injurious, aggressive behavior, agitation, and stressfulness, and some dysmorphic characteristics such as a long thin face, strabismus (hypertropia type), low set ears, wide nasal bone, and severe toe deformity, not previously reported for L1 syndrome or other L1CAM gene mutations. These differences can be due to variable expression related to the L1CAM gene mutations, which may be caused by modifier genes, epigenetics, or environmental factors. This study confirmed prior knowledge of a broad range of phenotypic manifestations of L1CAM gene mutations and the pleiotropic effects of the L1CAM gene.

In the second family (Family II), a novel deleterious hemizygous missense variant in the ZDHHC9 gene (NM_016032.4: c.566T>C, p.Leu189Pro) in two brothers with severe ID, developmental delay, and speech disorder (Figure 1-II-A) was identified. The ZDHHC9 gene is located on chromosome Xq26.1 and consists of 12 exons and encoded five transcripts. It encodes an integral membrane protein member of the zinc finger DHHC domain-containing protein family which forms a complex with golgin subfamily A member seven and functions as a palmitoyl transferase. This protein palmitoylates HRAS and NRAS [8]. The ZDHHC enzymes are implicated in several neurological and neurodevelopmental disorders. Loss-of-function mutations in the ZDHHC9 gene have been identified in XLID patients and are related to increased seizure risk [20]. According to the Human Gene Mutation Database (HGMD), LOVD³, ClinVar, and literature review, to date, about 18 pathogenic/likely pathogenic mutations have been identified, all of which are related to intellectual disability except one is related to an abnormality of the nervous system (Table 3). Hence, the ZDHHC9 gene is frequently associated with a syndromic condition called “Raymond-type X-linked syndromic intellectual developmental disorder (MRXSR, OMIM: 300799)” that is characterized by mild to severe intellectual disability, speech and language difficulties, and additional variable features including marfanoid habitus, epilepsy, facial dysmorphism, hypotonia, and behavioral problems. In family II, the c.566T>C (p. Leu189Pro) variant of the ZDHHC9 gene was identified, which is located on exon seven and in the DHHC domain that is required for palmitoyl transferase activity [8]. As a result of this study, this mutation causes the enzyme aberrant activity, leading to the disease conditions. In this Family, two brothers and their maternal uncle were studied (Figure 1-II-A), all three patients suffer from severe ID, developmental delay, and speech disorder that met the primary phenotype of the MRXSR, but there are some additional and variable clinical manifestations in these patients. The proband shows agenesis of the corpus callosum and Colpocephaly which is a new and previously unreported symptom in this condition. His elder brother has new clinical features, including vision problems, persistent leg pains, and muscle weakness beginning at six years of age. A similar vision problem has been encountered in their maternal uncle. These differences in phenotype between previous studies and within the presented family signify variable expression and pleiotropic effects of the ZDHHC9 gene (Table 3). Notably, vision and muscular problems may be due to the progression of the disorder by age (age-related onset). As few clinical features have been reported related to the variants of this gene, the genotype-phenotype correlations cannot be a result at this stage.

In the third family (Family III), a novel deleterious hemizygous missense variant in the GLRA2 gene (NM_002063.4:c.1048C>T, p.Arg350Cys) was identified. The GLRA2 gene is located on Xp22.2, consists of 13 exons, and encodes eight transcripts. GLRA2 is a protein-coding gene that encodes the alpha subunit of the glycine receptor; the glycine receptor consists of two subunits, alpha and beta, and acts as a pentamer. The transcript variants of this gene encode different isoforms. Glycine receptors are members of the cys-loop family of ligand-gated ion channels, accounting for mediating the inhibitory effects of glycine. They are widely distributed throughout the CNS, particularly within the hippocampus, spinal cord, and brain stem. It plays a role in the down-regulation of neuronal excitability and contributes to generating inhibitory postsynaptic currents [9]. Recent investigations have noted that missense variants in this gene can result in a loss, gain, or altered function of the encoded protein. In turn, missense variants are likely to either negatively or positively deregulate cortical progenitor homeostasis and neuronal migration in the developing brain, leading to changes in cognition, learning, and memory [21]. The most associated disorder with GLRA2 is X-Linked Intellectual Developmental Disorder, Syndromic, Pilorge Type (MRXSP, OMIM: 301076). The MRXSP is characterized by a global developmental delay with variably impaired intellectual development, speech delay, behavioral abnormalities, autism spectrum disorder (ASD), and more variable features, including motor incoordination, seizures, and ocular abnormalities. Based on our knowledge, to date, about 12 pathogenic/likely pathogenic variants have been reported according to literature, HGMD, LOVD³, and ClinVar (Table 4), most of which are related to MRXSP or ASD. Here, we identified a novel deleterious hemizygous missense variant (NM_002063.4:c.1048C>T, p.Arg350Cys) in this gene in a family with two affected boys with severe ID. They suffered developmental and speech delays, but some differences were found, including seizures in the elder brother and behavior problems in the younger one. In addition, Piton et al. (2011) previously described a pathogenic mutation in a similar amino acid codon (NM_002063.4(GLRA2):c.1049G>T, p.Arg350Leu), related to ASD [22]. After a while, Zhang et al. (2017) showed that the R350L mutation altered glycine receptor channel properties and kinetics, with increased inhibitory postsynaptic current (IPSC) and decreased decay times. The reduced decay times lead to longer duration of active periods, and increased conductance of the mutant channel indicated that the R350L mutation results in a gain-of-function effect [23]. In line with Piton et al. (2011) study, the two brothers of the current research in Family III also showed PDD, a subtype or milder type of ASD. The differences in phenotypic manifestation within these two brothers and between other studies may be due to the gene's variable expression or modifier genes and pleiotropic effects. We also encountered some facial features that have been reported for a likely pathogenic variant of this gene in ClinVar submission (ClinVar: RCV001813921.1), including some minor features: a broad face, prominent lips, broad eyebrows, long eyelashes, prominent eyelashes, and a broad nasal tip, which can expand the spectrum of clinical manifestations associated with the disorder. On the other hand, there are few detailed clinical features that have been reported related to this gene's variants, and the lack of such clinical details makes it impossible to find the genotype-phenotype correlations regarding this gene.

Family IV represents a novel deleterious hemizygous missense variant in the ATP2B3 gene. The ATP2B3 gene is located on Xq28 and consists of 26 exons. The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by forming an aspartyl phosphate intermediate during the reaction cycle [10]. The ATP2B3 gene encodes ATPase Plasma Membrane Ca2+, Transporting three involved in the maintenance of basal intracellular Calcium levels at the presynaptic terminals [24]. The most condition related to the ATP2B3 gene is X-linked Cerebellar ataxia-1 (SCAX1, OMIM: 302500), an X-linked recessive neurologic disorder characterized by hypotonia at birth, delayed motor development, gait ataxia, difficulty standing, dysarthria, and slow eye movements. Brain MRI shows cerebellar ataxia. To our knowledge, 10 pathogenic/likely pathogenic mutations in this gene have been reported according to literature, HGMD, LOVD³, and ClinVar databases (Table 5) related to SCAX1, ataxic disorders, and other neurological disorders. The studied family (Family IV) resulted in the NM_001001344.2, c.2541C>G, p.Asp847Glu variant on the ATP2B3 gene. Clinical findings matched other studies on ATP2B3 gene variants related to SCAX1 (Table 5). The proband and his maternal uncle (Figure 1-IV-A) both suffer from severe ID and seizure. The different clinical manifestations in the proband include neurodevelopmental delay, delayed milestones, no speech, no walking, hearing impairment, agitation, and excessive crying. He shows dysmorphic facial features such as strabismus, congenital hypotrichosis, and low eyebrow. His maternal uncles have movement disability in the left limb that began after multiple seizures early after birth. He also shows facial features such as a long face, prominent ear, low eyebrow, and broad nasal tip. Additionally, as shown in Table 5, missense changes are a common disease-causing mechanism in this gene. Another key finding in this study was the existence of subtle differences in some clinical features that suggest variable expression between and within families with the same gene defects. Again, few clinical features have been reported related to the variants of this gene, and the genotype-phenotype correlations cannot be resolved at the moment.

In conclusion, this study revealed three novel deleterious variants in three known genes on X- chromosomes by whole exome sequencing and described novel clinical findings in four unrelated families with XLID disorders. The results broaden the mutational and clinical spectrum of four rare XLID conditions and provide insights into this highly heterogeneous disorder. New mutational reports of families with detailed clinical descriptions will add to the existing knowledge and help to a comprehensive and clear picture of the genetic landscape of XLID.

Ethical approval & Consent to participate:

The research was performed according to the Declaration of Helsinki and was approved by the Ethics Committee of the Medical University of Isfahan (Ethics code: IR.MUI.MED.REC.1400.042).

Informed consent was obtained from all subjects and/or their parents or legal guardian(s) for this study.

Consent for publication:

Not Applicable

Data availability statement:

All data generated or analyzed during this study are included in this published article and the raw data that support the findings of this study are available from the corresponding author upon reasonable request. In addition, the datasets generated and/or analyzed during the current study are available in the ClinVar repository with accession numbers as: VCV000838485.11, VCV001705288.1, VCV001705404.3, VCV001705366.1.

Conflict of interests:

The authors declare that they have no conflict of interest.

Sources of funding:

This study was funded by the Medical University of Isfahan, Isfahan, Iran (Grant N0. 3991102) and research collaboration with 3Billion Inc., Seoul, South Korea.

Author contribution:

A.M.: recruitment of patients and family members, exome data analysis, mutation screening, performing molecular experiments and segregation analysis in families by Sanger sequencing, and writing the first draft of the manuscript; Y. S.: performing whole exome sequencing and data analysis; H.L.: performing whole exome sequencing and data analysis; H. K.: performing molecular analysis experiments for exclusion Fragile X syndromes; E.K.: analysis of structural effects of mutations; J.N.: patient identification and provision of clinical data; MA.T.: design and supervision of the research, review and editing the first draft of the manuscript.

Acknowledgments:

We sincerely thank families and patients who participate in this study. We are sincerely grateful to 3Billion Inc., Seoul, South Korea, for performing the whole exome sequencing. The Medical University of Isfahan also supported the study, Isfahan, Iran (Grant N0. 3991102). This is a part of A. M.’s Ph.D. thesis.

Ropers H, Hamel BC. X-linked mental retardation. Nat Rev Genet. 2005;6(1):46–57.
Chelly J, et al. Genetics and pathophysiology of mental retardation. Eur J Hum Genet. 2006;14(6):701–13.
Lisik MZ. Genetics of X-linked Mental Retardation, in eLS.
Kvarnung M, Nordgren A. Intellectual disability & rare disorders: a diagnostic challenge. Rare Dis Epidemiology: Update Overv, 2017: p. 39–54.
Lee Y-R, et al. Mutations in FAM50A suggest that Armfield XLID syndrome is a spliceosomopathy. Nat Commun. 2020;11(1):1–17.
De Luca C, et al. Challenges in molecular diagnosis of X-linked Intellectual disability. Br Med Bull. 2020;133(1):36–48.
Schäfer MKE, et al. L1 syndrome mutations impair neuronal L1 function at different levels by divergent mechanisms. Neurobiol Dis. 2010;40(1):222–37.
Swarthout JT, et al. DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras. J Biol Chem. 2005;280(35):31141–8.
Grenningloh G, et al. Alpha subunit variants of the human glycine receptor: primary structures, functional expression and chromosomal localization of the corresponding genes. Embo j. 1990;9(3):771–6.
Calì T, et al. A Novel Mutation in Isoform 3 of the Plasma Membrane Ca2 + Pump Impairs Cellular Ca2 + Homeostasis in a Patient with Cerebellar Ataxia and Laminin Subunit 1α Mutations. J Biol Chem. 2015;290(26):16132–41.
Seo GH, et al. Diagnostic yield and clinical utility of whole exome sequencing using an automated variant prioritization system. Evid Clin Genet. 2020;98(6):562–70.
Richards S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Sci. 2015;17(5):405–23.
Ye J, et al. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13(1):1–11.
Wang K, et al. MFEprimer-3.0: quality control for PCR primers. Nucleic Acids Res. 2019;47(W1):W610–3.
Tzschach A, et al. Next-generation sequencing in X-linked intellectual disability. Eur J Hum Genet. 2015;23(11):1513–8.
Vos YJ, Hofstra RM. An updated and upgraded L1CAM mutation database. Hum Mutat. 2010;31(1):E1102–9.
Fransen E, et al. Genotype-phenotype correlation in L1 associated diseases. J Med Genet. 1998;35(5):399–404.
Straussberg R, et al. X-linked mental retardation with bilateral clasped thumbs: report of another affected family. Clin Genet. 1991;40(5):337–41.
Jouet M, et al. New domains of neural cell-adhesion molecule L1 implicated in X-linked hydrocephalus and MASA syndrome. Am J Hum Genet. 1995;56(6):1304.
Shimell JJ, et al. The X-linked intellectual disability gene Zdhhc9 is essential for dendrite outgrowth and inhibitory synapse formation. Cell Rep. 2019;29(8):2422–37. e8.
Chen X, et al. Loss, Gain and Altered Function of GlyR α2 Subunit Mutations in Neurodevelopmental Disorders. Front Mol Neurosci. 2022;15:886729.
Piton A, et al. Systematic resequencing of X-chromosome synaptic genes in autism spectrum disorder and schizophrenia. Mol Psychiatry. 2011;16(8):867–80.
Zhang Y, et al. Structure-function analysis of the GlyR α2 subunit autism mutation p. R323L reveals a gain-of-function. Front Mol Neurosci. 2017;10:158.
Calì T, et al. A novel mutation in isoform 3 of the plasma membrane Ca2 + pump impairs cellular Ca2 + homeostasis in a patient with cerebellar ataxia and laminin subunit 1α mutations. J Biol Chem. 2015;290(26):16132–41.
Hu H, et al. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes. Mol Psychiatry. 2016;21(1):133–48.
Raymond FL, et al. Mutations in ZDHHC9, which encodes a palmitoyltransferase of NRAS and HRAS, cause X-linked mental retardation associated with a Marfanoid habitus. Am J Hum Genet. 2007;80(5):982–7.
Bowling K, Thompson M, Amaral M. Genomic diagnosis for children with intellectual disability and/or developmental delay Genome Med. 2017;9:43.
Masurel-Paulet A, et al. Expanding the clinical phenotype of patients with a ZDHHC9 mutation. Am J Med Genet Part A. 2014;164(3):789–95.
Grozeva D, et al. Targeted next-generation sequencing analysis of 1,000 individuals with intellectual disability. Hum Mutat. 2015;36(12):1197–204.
Anazi S, et al. Expanding the genetic heterogeneity of intellectual disability. Hum Genet. 2017;136(11):1419–29.
Boone PM, et al. Detection of clinically relevant exonic copy-number changes by array CGH. Hum Mutat. 2010;31(12):1326–42.
Schirwani S, et al. Expanding the molecular basis and phenotypic spectrum of ZDHHC9-associated X‐linked intellectual disability. Am J Med Genet Part A. 2018;176(5):1238–44.
Willemsen MH, et al. Interpretation of clinical relevance of X-chromosome copy number variations identified in a large cohort of individuals with cognitive disorders and/or congenital anomalies. Eur J Med Genet. 2012;55(11):586–98.
Iossifov I, et al. The contribution of de novo coding mutations to autism spectrum disorder. Nature. 2014;515(7526):216–21.
Pilorge M, et al. Genetic and functional analyses demonstrate a role for abnormal glycinergic signaling in autism. Mol Psychiatry. 2016;21(7):936–45.
Chen X et al. Loss, gain and altered function of GlyR α2 subunit mutations in neurodevelopmental disorders. Front Mol Neurosci, 2022. 15.
Marcogliese PC, et al. Drosophila functional screening of de novo variants in autism uncovers damaging variants and facilitates discovery of rare neurodevelopmental diseases. Cell Rep. 2022;38(11):110517.
Pergande M, et al. The genomic and clinical landscape of fetal akinesia. Genet Sci. 2020;22(3):511–23.
Retterer K, et al. Clinical application of whole-exome sequencing across clinical indications. Genet Sci. 2016;18(7):696–704.
Al-Mubarak B, et al. Whole exome sequencing reveals inherited and de novo variants in autism spectrum disorder: a trio study from Saudi families. Sci Rep. 2017;7(1):1–14.
Vicario M et al. A novel PMCA3 mutation in an ataxic patient with hypomorphic phosphomannomutase 2 (PMM2) heterozygote mutations: Biochemical characterization of the pump defect. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 2017. 1863(12): p. 3303–12.
Zanni G, et al. Mutation of plasma membrane Ca2+ATPase isoform 3 in a family with X-linked congenital cerebellar ataxia impairs Ca2+homeostasis. Proc Natl Acad Sci. 2012;109(36):14514–9.
Helbig KL, et al. Diagnostic exome sequencing provides a molecular diagnosis for a significant proportion of patients with epilepsy. Genet Sci. 2016;18(9):898–905.
Charng W-L, et al. Exome sequencing in mostly consanguineous Arab families with neurologic disease provides a high potential molecular diagnosis rate. BMC Med Genom. 2016;9(1):1–14.

Tables 1 to 5 are available in the Supplementary Files section

No competing interests reported.

Tables.docx

Download PDF

Journal Publication

published 11 Oct, 2023

Read the published version in BMC Medical Genomics →

Editorial decision: Major revision
28 Jul, 2023
Reviews received at journal
04 Jul, 2023
Reviewers agreed at journal
04 Jul, 2023
Reviewers invited by journal
04 Jul, 2023
Editor assigned by journal
19 May, 2023
Editor invited by journal
21 Apr, 2023
Submission checks completed at journal
21 Apr, 2023
First submitted to journal
18 Apr, 2023

You are reading this latest preprint version

Four families with X-linked intellectual disability affected males: Novel deleterious variants and clinical features with the review of literature

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Subjects And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1