Clinical samples
Selection in September 2014 to September 2017 tangshan worker hospital cases cervical biopsy and surgical treatment, clinical data integrity, and did not receive preoperative radiation and chemotherapy treatment, a total of 152 cases, of which the normal cervical 34 cases (control), cervical intraepithelial neoplasia (CIN) in 78 cases (including CIN Ⅰ 31 cases, CIN Ⅱ - Ⅲ 47 cases) and 40 cases cervical squamous cell carcinomas (SCC). The general conditions of the patients were investigated, and the age of the patients, age of menarche, number of sexual partners, number of pregnancies, number of abortions, smoking and drinking had no statistical significance (P >0.05). The median age of all participants was 45 and ranged from 25 to 79. After diagnosis, they underwent surgical resection of primary cervical cancer in the Department of Obstetrics and Gynecology of Tangshan workers' hospital. The histological types and grades of tumors were classified according to WHO criteria. The stage of each cancer was determined according to the International Federation of Gynaecology and Obstetrics (FIGO 2000) criteria. According to the agency guidelines, all of these patients had obtained informed consent prior to sample collection, and the study was approved by the Ethics Committee of North China University of Technology in Tangshan, Hebei province, China.
Cell culture
Human normal cervical epithelial cell (HcerEpic) and human cervical (HeLa, SiHa and C33A) cancer cell lines were purchased from the Cell Culture Center (Manassas, VA). And containing RPMI 1640 medium containing 10% fetal bovine serum, 5% carbon dioxide, 37℃ constant temperature incubator, logarithmic growth phase cells were used for the following experiments.
Adenoviral vector, siRNA and transfection
Ad-KLF5 and Ad-GFP were made as described previously [13]. Hela cells were infected with Adenoviral vector (Genechem Co., Ltd). To achieve RNAi-mediated depletion of Eppk1, we transfected cells with siRNA oligos targeting Eppk1 or negative controls (Genechem Co., Ltd). In this process, we also used the Lipofectamine 2000 reagents (Invitrogen; Thermo Fisher Scientific, Inc.) according to the operation instructions.
Immunofluorescence staining.
All cervical tissue samples were fixed by 4% paraformaldehyde solution, the fixed tissue was dehydrated by ethanol, transparent by xylene, embedded in paraffin, and the sections were 4 μm. The above samples were operated by indirect immunofluorescence method according to the instructions. rabbit anti-KLF5 (1:50, GTX103289, GeneTex) and mouse anti-Eppk1 (1:50, sc-87102, Santa) were incubated overnight at 4℃, Fluorescein labeled fluorescent secondary antibody, Rhodamine labeled fluorescent secondary antibody (KPL) and DAPI (Sigma) nuclear staining. Image Pro-Plus6.0 (Media Cybernetics, Inc, USA) Image analysis software analyzed the fluorescence intensity of Eppk1 and KLF5 expressions.
Real-time PCR
Total tissue RNA was extracted from the cervical tissues preserved in liquid nitrogen according to the instructions of Trizol kit. RNA was used as template, cDNA was synthesized by reverse transcription kit (Invitrogen, USA), and then cDNA was used as template for Real-time PCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal reference. Apply Primer Premier software, design and downstream primers respectively: Eppk1 upstream Primer sequences for 5'- GGCCATGCCGATTTAAATGC-3', The downstream primer sequences for 5'- CAAGCAAAGTCAGTCCAAGC-3'. The upstream primer sequence of GAPDH was 5'- CGTCCCGTAGACAAAATGGT-3'. The downstream primer sequence of GAPDH is 5'- GAGGTCAATGAAGGGGTCG-3'. Amplification reaction conditions: 95℃, 2min, 95℃, 15s, 72℃, 35s, 40 cycles. Formula 2-△△Ct (Ct as the circulating threshold) was used to calculate the mRNA expression level of the target gene, and the experiment was repeated 3 times for each group.
Western blotting
A RIPA kit (Beyotime Institute of Biotechnology) was operated to extract total proteins from treated cells, the total protein content was detected by the protein assay kit (Beyotime Biotechnology). SDS-PAGE was used to separate the protein samples with 8-12% separating gel and every protein sample added in the well was 40 µg. The separated proteins was resolved and electrophoretically moved to the PVDF membranes. After blocked with 5% defatted milk in TBST at room temperature for 1.5 h, the blots were incubated with primary antibodies for a night at 4℃. The secondary antibody (1:2000) was incubated at room temperature, the membrane was washed, and the film was developed. The β-actin is the internal reference protein. The signals were detected with the ECL system (Pierce) and quantifed by scanning densitometry with the Image J analysis. The primary antibodies includes anti-KLF5 antibodies (1:1,000, GTX103289, GeneTex), anti-Eppk1 antibodies (1:1,000, sc-87102, Santa), anti-p38 antibodies (1:1000, 14064-1-AP, Proteintech), p-p38 (1:1000, 14064-1-AP, Proteintech), AKT (1:1000, 10176-2-AP, Proteintech), p-AKT (1:1000, 66444-1-Ig, Proteintech), p-ERK1/2 (1:1000, cat. no.9101, Cell Signaling), ERK (1:1000, 16443-1-AP, Proteintech) and β-actin (1:5000, 20536-1-AP, Proteintech).
Dual luciferase assays
Lipofectamine-2000 was used to co-transfect pGL3-basic (negative control) vector, pGL3-Eppk1promoter, pGL3-Eppk1 promoter mutation, plasmid-expressed KLF5 or empty plasmid. The concentration of each plasmid was 0.5 μg/well. Meanwhile, pRL-β-actin 10 ng/well was co-transfected as internal reference. At 24 h after transfection, the cells were transfected with empty plasmid (pcDNA3.1) and plasmid-expressed KLF5 (pcDNA3.1-KLF5). At 48 h after transfection, luciferase activity was measured using the dual-luciferase reporter assay system (Promega) The experiment was repeated three times, and the average value of the data was calculated.
Chromatin immunoprecipitation assays
The chromatin immunoprecipitation assay was performed using the HeLa cells following the protocol provided by Abcam (Cambridge, MA, USA). The diluted DNA- protein complex was incubated with an equal amount of anti-Eppk1 antibody or mouse IgG (Santa Cruz) overnight at 4℃ in the presence of herring sperm DNA and protein A/G beads. Chromosomal DNA was purified and analyzed by RT-qPCR. The PCR primers for the Eppk1 gene promoter to amplify the KLF5-binding region were as follows: Forward: 5'TGGGGCCTGGTGGGGGGAAAG 3'; Reverse: 5'GGCCGGCCCCCTCTGACTCA 3'.There were three groups of samples: IgG (negative control), Input (positive control) and Ad- KLF5.
Cell proliferation assay
CCK-8 assay was used to detect the growth and proliferation of Hela cells. Hela vaccination in 96-well plates, 100 μl per hole cell suspension, after waiting for cell adherent to group training, each group have 3 hole, cultivate 12 h, 24 h, 48 h, 72 h, 96 h after 10 μl per hole to join CCK 8 solution, set a zero cell free hole, incubator to 4h incubation, enzyme standard instrument determination at 450nm OD value.
Statistical analysis
Data provided as mean ± standard deviation (`x±s) was analyzed with SPSS13.0 (SPSS, Inc.) and GraphPad Prism 5.0 (GraphPad Software, Inc.). The pathological data collected from the samples was compared by using Chi-square test. Contrasts between two groups were performed through an unpaired two-tailed t test. One-way ANOVA was used for multiple comparisons followed by the post hoc Turkey’s test. P < 0.05 was considered statistically significant.