2.1. cDNA microarray and analysis
Total RNA was isolated from RKO cells transfected with shCtrl and shNME4. The quality assessment of microarray data was done by Shanghai Xiaoyan Biotechnology Company (Shanghai, China) on the microarray data, and all probes with mean values less than 0.005 were filtered out. A linear model based on empirical Bayesian distribution was calculated for the significant difference level P-value and corrected for the significant difference level (FDR) with the Benjamini-Hochberg method [21]. The screening criteria for significantly differential genes were |Fold Change| ≥ 1.5 and FDR < 0.05. Differentially expressed genes were further computationally simulated by Ingenuity Pathway Analysis (IPA; QIAGEN, Valencia, CA, USA) online tool to predict downstream regulators and signaling pathways potentially regulated by CYBA.
2.2. Patients
92 patients diagnosed with CRC from in the First Hospital of Zhejiang University of Traditional Chinese Medicine were recruited for this study. All patients did not receive chemotherapy or radiotherapy pre-surgery. CRC tissues were collected during surgery. All cases were staged according to the American Joint Committee on Cancer (AJCC) 7th edition cancer staging manual. Clinical information and pathological data were collected from patients, and follow-up studies were performed and recorded for a period of X months after surgery for all patients. The study was approved by the First Hospital of Zhejiang University of Traditional Chinese Medicine. All patients signed a written informed consent before participation in the study.
2.3. Tissue microarrays analysis
Microarrays of colorectal and paracancerous tissues were prepared as berore [22]. The expression levels of NME4 and SMAD2 in CRC tissues were examined by immunohistochemical analysis.
2.4. Cell culture and treatment
The RKO cell line obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) was cultured in DMEM (Gibco) of 10% fetal bovine serum (FBS) and incubated at 37°C and 5% CO2 in a humidified atmosphere. NME4 and SMAD2 knockdown lentiviral plasmid (shRNA) were constructed. Negative controls and plasmids were transfected into cells with Lipofectamine 3000 (Invitrogen, CA, USA) and incubated for 2 days.
2.5. Coimmunoprecipitation (Co-IP) assay
For Co-IP assays, cells were lysed with lysis buffer according to the manufacturer's protocol (Invent Biotechnologies, USA). Nuclear protein lysates were immunoprecipitated with antibodies specific for NME4, SMAD2, or IgG negative control in a spinner overnight at 4°C. The lysates were then slowly spun with 50 µL of Protein A/G magnetic beads pre-cleaned with PBST for 2 hours at 4°C. Following washing the magnetic beads 4 times, the immunoprecipitated complexes were isolated and further analyzed by Western blotting.
2.6. Cell viability assay
Cell viability was measured using the CCK-8 assay kit. Treated RKO cells were inoculated into 96-well culture plates (2000 cells/well) for 12 hours. CCK-8 (100 µL/well) was supplemented and incubated for 2 hours. The absorbance at 450 nm was measured by microplate reader (BioTek, Winooski, VT) and the growth curve was plotted.
2.7. In vivo tumorigenesis
Four-week-old female BALB/c-nude mice were utilized for subcutaneous xenograft experiments. shCtrl or shNME4 (1×106) was subcutaneously injected into the mice. Tumor size was measured every 5 days with calipers and calculated with the formula: volume = length × (width2)/2. At the end of the study, mice were executed under deep anesthesia and tumor tissue was removed. After intraperitoneal injection of D-luciferin (150 mg/kg), tumor growth was monitored by bioluminescence imaging by the IVIS system. After imaging several time points, the animals were euthanized. All animal experiments were performed according to institutional guidelines and approved by the First Hospital of Zhejiang University of Traditional Chinese Medicine.
2.8. Hematoxylin and eosin (H&E) staining
The collected tumor tissue was fixed in 10% formalin and embedded in paraffin. After cutting the tumor tissues into 4-µm-thick sections, wax was removed and processed. Then, the sections were stained with H&E (Baso, BA4041, BA4042). Visualization was performed under a light microscope (Leica DM5000B, Germany).
2.9. Ki67 staining
After dewaxing the tissue sections, the antigen was recovered with citrate buffer (Sangon Biotech, Shanghai, China) under autoclave conditions. Then the sections were blocked with 5% normal goat serum for 1 h at 25℃ and incubated with antibodies against Ki67 (1:100; Abcam, ab16667) overnight at 4°C. Subsequently, sections were treated with HRP anti-rabbit IgG (1:400; Abcam, ab97080). Images were obtained under a light microscope (Leica DM5000B, Germany).
2.10. Wound healing assay
Cells were seeded in 6-well plates (70,000 cells/well) and cultured to 100% confluence. Scrape the cell layer on the surface at the plate with a 200 µL sterile plastic tip and remove the suspended cells with PBS. Culturing the cells in medium without FBS and capturing images of the cells at 0 and 24 hours.
2.11. Quantitative Real-Time PCR (qRT-PCR) analysis
Total RNA was extracted with TRIzol reagent (Invitrogen) and qRT-PCR was carried out according to the previously described method. qRT-PCR reactions were performed in duplicate and repeated three times. Data analysis was performed with 2−ΔΔCT [23] using GAPDH as an internal reference. The primers are in Table 1.
Table 1
Gene | Forward 5′-3′ | Reverse 5′-3′ |
NME4 | GCCCTTCTACCCTGCCCTCA | CGTGGATGACATTCCTGCTGAT |
SKI | TCTCGCCACTTGCACCCA | TCCTCCCTGCTTTCAACTTCC |
SMAD2 | GAAGGCAGACGGTAACAA | TGAGCAACGCACTGAAGG |
SMAD6 | CATCACTGCTCCGGGTGAATT | GGTCGTACACCGCATAGAGGC |
MYC | CTGCGACGAGGAGGAGAA | CCGAAGGGAGAAGGGTGT |
BMP2 | CTGTATCGCAGGCACTCA | GAATCTCCGGGTTGTTTT |
BCL-2 | CTGGGAGAACAGGGTACGATAA | GGCTGGGAGGAGAAGATGC |
BMPR1A | AAGTTCTGGTAGTGGGTCT | CTGGCTTCTTCAGTGGTA |
RPS27A | GATCCAGGATAAGGAAGG | ACCACCACGAAGTCTCAA |
HRAS | TTTGCCATCAACAACACCA | TCCTGAGCCTGCCGAGAT |
HSPB1 | CAAGGATGGCGTGGTGGA | TCTCGTTGGACTGCGTGGC |
RPSA | GGGTTTGATGTGGTGGAT | TTGGTCACTGCCTTCTCA |
PTEN | ACCATAACCCACCACAGC | CAGTTCGTCCCTTTCCAG |
GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
Table 2
Expression patterns in breast cancer tissues and para-carcinoma tissues revealed in immunohistochemistry analysis.
NME4 expression | Tumor tissue | Para-carcinoma tissue | p value |
Cases | Percentage | Cases | Percentage | 0.000*** |
Low | 24 | 26.1% | 72 | 78.2% |
High | 68 | 73.9% | 20 | 21.8% |
2.12. Western blot analysis
Total proteins were extracted from tumor tissues and cells with cell lysis buffer (RIPA, Beyotime) containing protease inhibitors (PMSF, Boster, China). The protein concentration was measured with a BCA assay kit (Thermo Fisher Scientific, Shanghai, China). Proteins were transferred onto polyvinylidene difluoride (PVDF, Millipore, MA, USA) membranes after electrophoresis of 20 µg aliquots of protein in 10% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE). Subsequently, the membranes were incubated with primary antibodies overnight at 4°C after blocking with 5% skim milk for 1 hour at room temperature. Primary antibodies included anti-NME4 (1:3000, #ab228005, Abcam, UK), anti-SMAD2 (1:2000, # ab40855, Abcam, UK), anti-MYC (1:1000, #ab32072, Abcam, UK), anti-SMAD6 (1:1000, #ab273106, Abcam, UK), anti-PTEN (1:2000, #ab170941, Abcam, UK), anti-RPS27A (1:1000, #ab172293, Abcam, UK) and anti-GAPDH (1:3000, #ab8245, Abcam, UK). The following day, membranes were incubated with HRP goat anti-rabbit IgG secondary antibody (1:3000, #A0208, Beyotime, China) for 1 h at room temperature. Chemiluminescence was detected on a FluorChem FC system (Alpha Innotech) using an ECL kit (Millipore, USA) and protein expression was evaluated by ImageJ software.
2.13. Statistical analysis
All experimental data are presented as the standard error of the mean (mean ± SD). Statistical analysis was conducted using GraphPad Prism software 8.0 (San Diego, CA, USA). A two-tailed Student's t-test was applied to compare data differences between the two groups. Survival analysis was estimated from the KM Plotter database. Overall survival was estimated using the Kaplan-Meyer method and the logit test. In addition, variables that were statistically significant in the univariate analysis were included in the multifactorial analysis. Correlations between NME4 and SMAD2 expression and clinicopathological characteristics were estimated by chi-square test. For all clinical analyses, * p < 0.05, ** p < 0.01 and *** p < 0.001 were regarded as statistically significant.