2.1 Animals and Treatments
Male SPF Sprague–Dawley (SD) rats (250–300g) were purchased from Qinglongshan Animal Farm of Nanjing, China (Production License No. SCXX (su) 2018-0019; SCXK (zhe) 2019-0002). All animals were housed under a 12 hour light-dark cycle at temperature of 22-26℃ in a room of 40-70% humidity. Rats were fasted for 12 hours before the surgery. Rats were randomly divided into 4 groups: (1) sham operation group; (2) MCAO/R model group; (3) Indobufen (20 mg/kg) group; (4) Aspirin (10 mg/kg) group. The in vivo trial was divided into 5 day prophylactic administration (5-day tests) and 15 day therapeutic administration (15-day tests). In the 5-day prophylactic administration experiment, oral administration was given for 5 days, and surgery was performed 30min after the 5th-day administration. In the 15-day treatment administration experiment, the drugs were administered 3 hours after the operation, once a day for 15 days. All rats were kept at a relative humidity of 55 ± 5% (at 25 ± 2 ℃) in compliance with institutional guidelines of China Pharmaceutical University and the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). All experiments were approved by the Institutional Animal Care and Use Committee of China Pharmaceutical University (SYXK (Su) 2016-0011).
2.2 Drug administration
Indobufen (Huadong medicine Co., LTD) and Aspirin (Shanghai yuanye Bio-Technology Co., LTD) were both dissolved in 0.5% sodium carboxymethyl cellulose (CMC-Na). Drugs were administered intragastrically with a volume of 0.5mL/100g body weight. Sham and model group were given the same volume of 0.5% CMC-Na.
2.3 In vivo MCAO/R establishment
MCAO/R injury was established as previously described after anesthetization with 3% isoflurane [12] with 2h of ischemia followed by reperfusion. Rats were maintained anesthetized with 3% isoflurane in O2 throughout the surgery by a respirator mask and fixed in the supine position to alleviate their pain. After the operation, the rats with successful surgery according to the behavioral scoring were retained. All efforts were made to minimize animal suffering and reduce the number of animals used. Five rats died from anesthesia and ten died from intracranial hemorrhage, which were excluded in the analysis.
2.4 Neurological defect scoring, cylinder test and postural reflex test
One days following MCAO/R, the neurological function of the rats was scored from 0 to 4 according to Bederson’s method [13]. For the limb-use asymmetry test and postural reflex test, the rats were tested as previous reported [3]. In 5-day tests: neurological scoring was conducted at 24 h after reperfusion. In 15-day tests: cylinder test and posture reflex test were carried out 30 min after drug administration as shown in Figure 2B.
2.5 Measurement of infarct size
In the 5-day tests, rats were sacrificed by cervical dislocation 24h after the MCAO surgury and in the 15-day tests, rats were sacrificed by cervical dislocation 30min after the last drug-administration. 2,3,5-Triphenyltetrazolium chloride (TTC, Sangon Biotech CO., LTD) stainng were used to measure brain infarct size [14]. The percentage of infarction was calculated as following: Infarct rate (%) = (left hemisphere area – right white brain infarction area)/left hemisphere area × 100%.
2.6 Evaluation of brain edema
Brain sections were weighed right after TTC staining to obtain wet weight. Then the brain was placed in an oven at 110 ℃ for 24 h to dry to constant weight to obtain dry weight, and the brain water content was calculated: Brain water content (%) = (1 – dry weight/wet weight) × 100% [15].
2.7 Morris water maze (MWM)
In the 15-day tests, Morris Water Maze evaluation was conducted as mentioned before [16, 17]. The escape latency and swimming path were recorded along the first five days and percentage of time spent in the quadrant IV and number of crossing platform was measured in probe trial of the fifth day of MWM.
2.8 Assay of Intracellular Total ROS Levels
By measuring the fluorescence intensity of 2, 7-dichlorodihydrofluorescein diacetate (DCFH-DA), ROS production in the ischemic penumbra of rats in the 5-day administration group was evaluated by ROS kit (Nanjing Jiancheng Bioengineering Institute). At 24h after MCAO/R, 0.1g ischemic penumbral zone was taken from rats in each group. Single-cell suspension was prepared by pancreatin digestion method and treated with 10 μM DCFH-DA PBS for 45 min. The excess dye was removed with PBS. DCF fluorescence was determined using multifunctional microplate reader (POLARstar Omega, USA) with 485-nm excitation and 525-nm emission filters [18].
2.9. Primary cell culture of HUVECs
Primary cultures of Human umbilical vein endothelial (HUVEC) were purchased from ScienCell Research Laboratories, Inc (Cat. #8000). Endothelial cell medium (ECM, ScienCell Research Laboratories, Inc, Cat. #1001) containing 5% heat-inactivated fetal bovine serum (FBS) with 100 U/mL penicillin and 100 μg/mL streptomycin was used and cells was placed in a humidified atmosphere with 5% CO2 at 37 ℃. The medium was changed every 2 days.
2.10. Oxygen-glucose deprivation followed by recovery (OGD/R)
HUVEC cells were randomly divided into groups below: (1) control; (2) OGD/R; (3) Indobufen (200 μM) (4) Aspirin (100μM);. All groups were incubated for 24 h with medium containing different drugs. Then HUVEC cells were subjected to hypoxic conditions (95% N2, 5% CO2) with no-glucose DMEM for 4 h, followd by reoxygenation for 2 h [19].
2.11. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) Assay
Cell viability was determined by MTT assay (Wanleibio, Shenyang, China; LOT#16B109). The optical density (OD) value at 570nm was measured to calculate the cell viability as follows: Cell viability (%) = (OD value in the administration group-OD value in the solvent control group)/ (OD value in the blank group-OD value in the solvent control group) ×100%.
2.12. ELISA assay
The concentrations of 6-keto-PGF1α and TXB2 in the brain tissue homogenates and culture cell supernatants were assessed by ELISA (Nanjing Jiancheng Bioengineering Institute) according to manufacturer’s instructions. The levels were normalized to cell protein concentrations.
2.13. Real-time PCR
Changes in mRNA levels of IL-18, IL-1β and NLRP3 were detected in brain tissues in the 5-day pretreatment groups, and real-time PCR was performed as described previously [20]. Quantitative PCR (Mastercycler ep realplex, Eppendorf) was performed in the presence of SYBR Green I. Expression of IL-18, IL-1β and NLRP3 was normalized to to β-actin analyzed by 2-ΔΔCt. The primers (Sangon Biotech Co., LTD., Shanghai, China) were as follows:
Rat IL-18-F: ACCGCAGTAATACGGAGCAT; R: GTCTGGGATTCGTTGGCTGT
Rat IL-1β-F: AGGCTGACAGACCCCAAAAG; R: CTCCACGGGCAAGACATAGG
Rat NLRP3-F: GTGGAGATCCTAGGTTTCTCTG; R: CAGGATCTCATTCTCTTGGATC
Rat-β-actin-F: AGACCTTCAACACCCCAG; R: CACGATTTCCCTCTCAGC
2.14. Immunofluorescence (IF) assay
At 24 h after MCAO/R in the 5-day pretreatment groups, the rats were anesthetized, 4% paraformaldehyde was perfused through the heart, and brain tissue was quickly removed and fixed in 4% paraformaldehyde. Brain samples were performed on fixed frozen ultrathin sections (Leica CM3050s, Germany) as previously described [21]. As for in vitro experiments, HUVEC cells were fixed with 4% paraformaldehyde for 20 min after OGD/R treatment. Thereafter, brain sections or culture cells were incubated with rabbit antibody NF-κB p65 (1:200, Cell Signaling Technology), rabbit antibody NLRP3 (1:100, proteintech, Wuhan, China; CAT#17168-1-AP) or rabbit antibody Caspase-1 (1:100, proteintech, Wuhan, China; CAT#22915-1-AP) at 4 ℃ overnight. After being rinsed with 0.3% Triton-X PBS (PBST), cells were incubated with goat anti-rabbit IgG/Cy3 antibody (1:200; Bioss, Beijing, China; CAT#bs-0295G-Cy3) or goat anti-rabbit IgG (H+L) (1:200, proteintech, Wuhan, China; CAT#SA00013-4) in dark for 2h, and then stained with 4',6-diamidino-2-phenylindole (DAPI, Beyotime Institute of Biotechnology, Shanghai) for 30 min. Images were captured with a fluorescence microscope (Nikon Ts2R, Japan).
2.15. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) and GSDMD co-staining
The pyroptosis cells emerged from rat MCAO/R or HUVECs OGD/R were detected by TUNEL staining and immunofluorescence assay. The brain slides or HUVEC cells were incubated with GSDMD rabbit antibody (1:100, abbexa, Houston, TX, USA CAT#abx136074) overnight at 4 ℃. Subsequently, CoraLite594-conjugated goat anti-rabbit IgG (H+L) (1:200, proteintech, Wuhan, China; CAT#SA00013-4) was incubated for 2 h. TUNEL staining (Keygenbiotech, Nanjing, China; CAT#KGA7073) were processed followed with DAPI staining for 30 min and photograph by a fluorescence microscope (Nikon Ts2R, Japan).
2.16. Western blot analysis
Total protein and cytoplasmic/nucleoprotein were extracted from brains of rats or HUVEC cells after different treatments according to the instructions of the respective extraction kits (Beyotime Institute of Biotechnology, Shanghai, China). Equivalent protein samples (50 μg) of brain tissues or HUVEC cells were separated by 10% SDS/PAGE gel electrophoresis. Following primary antibodies were incubated: rabbit antibody NF-κB p65 (1:1000, Cell Signaling Technology), rabbit antibody Caspase-1 p20 (1:500, Wanleibio, Shenyang, China), mouse antibody β-actin (1:1000, proteintech, Wuhan), and rabbit antibody Histone H3 (1:1000, proteintech, Wuhan, China) and membranes were visualized via chemiluminescence.
2.17. Statistical analysis
The data in this study were expressed as mean ± SD. Kruskal-Wallis test was used for behavioral tests, the number of crosses in the probe test in quadrant IV of MWM. The remaining data were analyzed by one-way ANOVA followed by Bonferroni test post hoc test for equal variance data and Dunnett 3 post hoc test for unequal variance by IBM SPSS 25.0 software. Differences were considered significant when p-values were smaller than 0.05. Photoshop 2020, Image J and GraphPad Prism Version 8.0 were used for statistical analysis.