Genetic Relationship Evaluation of SSR Analyzes
Molecular markers have a power to detect DNA polymorphism at the specific locus level as well as at the genome level. Microsatellites are useful in determining heterozygosity and calculating genetic distances between closely related species. Moreover, it is stated that they are suitable for determining genetic indices such as effective allele number as well as PIC in the population. Allele number and allele frequency are measures of genetic diversity in a population. The greater the number of alleles, the greater the genetic diversity. In addition, the closer the allele frequencies are to each other, the greater the diversity [30].
As a result of 5 genomic SSR markers used in our study, the genetic relationship among 11 chestnut cultivars were successfully determined and the similarities/differences among these chestnut cultivars could be determined. In our study, allele size ranges of SSR markers were determined as 23–976, 19–976, 19–976, 18–977 and 20–976 bp, respectively (Table 1). Polymorphism (P) was detected in all 507 bands (100%) obtained after amplification of SSR markers. For eleven chestnut cultivars, the SSR primer giving the highest number of polymorphic alleles was CsCAT3 (122 alleles), while the SSR primer giving the lowest number of polymorphic alleles was CsCAT1 (76 alleles) (avg. 101.4 alleles for all cultivars) (Table 1). In our study, the numbers of average allele (avNa) obtained from SSR markers for 11 chestnut cultivars were 6.91 (CsCAT1), 11.09 (CsCAT3), 8.82 (CsCAT6), 9.55 (CsCAT16) and 9.73 (EMCs38) (Table 1). On the other hand, by Martin et al. [19] studying in chestnut populations, the number of average allele obtained from CsCAT1, CsCAT3, CsCAT6, CsCAT16 and EMCs38 markers were recorded as 10, 22, 16, 10 and 18, respectively, while allele size ranges were determined as 174–221, 189–269, 158–196, 124–153 and 229–270 bp, respectively. The number of average allele was determined as 2.85 with the same markers in Janfaza et al. [25]. In a study carried out in chestnuts, the number of allele for CsCAT1, CsCAT6, CsCAT16 markers were determined as 5, 6 and 2, respectively, while allele size ranges were determined as 190–236, 182–224 and 148–148 bp, respectively [20]. According to Marinoni et al. [13], using the SSR markers CsCAT1, CsCAT3, CsCAT6, CsCAT16 in chestnuts, a low number of alleles (Na) (6, 4, 3 and 4, respectively) were detected. On the other hand, the numbers of allele were determined as 27 (CsCAT3) and 11 (CsCAT16) by Fernandez-Cruz and Fernandez-Lopez [22]. In Martin et al. [19], the level of genetic diversity was successfully determined with the help of SSR markers named CsCAT1, CsCAT3, CsCAT6, CsCAT16 and EMCs38. Furthermore, in the same study, the highest effective allele number (Ne) values were obtained as 10.53 (CsCAT3), 9.26 (EMCs38) and 7.28 (CsCAT). For the same markers, the Ne values in Mattioni et al. [17] were obtained as 3.35, 4.44 and 4.04, respectively. In Fernandez-Cruz and Fernandez-Lopez [22], the Ne values of CsCAT3 and CsCAT16 markers were determined as 3.90 and 3.09, respectively. In Janfaza et al. [25], the average Ne value obtained with the help of SSR markers (not used in our study) was determined as 2.163 in chestnuts obtained from 4 different populations.
Table 1
Some parametres obtained with genomic SSR markers for eleven chestnut cultivars
SSR loci | Locus Motif | Forward / Reverse primer sequences (5’→3’) | Ta (oC) | SR (bp) | avNa | Na | Npa | P (%) | Havp | PIC | MI | D |
CsCAT1 | (TG) | F: GAGAATGCCCACTTTTGCA | 50.0 | 23–976 | 6.91 | 76 | 76 | 100 | 0.464 | 0.339 | 0.464 | 0.410 |
| R: GCTCCCTTATGGTCTCG |
CsCAT3 | AG | F: CACTATTTTATCATGGACGG | 51.5 | 19–976 | 11.09 | 122 | 122 | 100 | 0.442 | 0.345 | 0.442 | 0.435 |
| R: CGATTGAGAGTTCATACTC |
CsCAT6 | (AC)AT(AC) | F: AGTGCTCGTGGTCAGTGAG | 58.3 | 19–976 | 8.82 | 97 | 97 | 100 | 0.351 | 0.366 | 0.351 | 0.370 |
| R: CAACTCTGCATGAATAAC |
CsCAT16 | TC | F: CTCCTTGACTTTGAAGTTGC | 58.3 | 18–977 | 9.55 | 105 | 105 | 100 | 0.355 | 0.366 | 0.355 | 0.375 |
| R: CTGATCGAGAGTAATAAAG |
EMCs38 | AG | F: TTTCCCTATTTCTAGTTTGTGATG | 60.0 | 20–976 | 9.73 | 107 | 107 | 100 | 0.405 | 0.355 | 0.405 | 0.393 |
| R: ATGGCGCTTTGGATGAAC |
| | Average | 9.22 | 101.4 | 101.4 | 100 | 0.395 | 0.357 | 0.395 | 0.393 |
| | Total | 46.10 | 507 | 507 | | | | | |
Ta: annealing temperature (oC), SR: size range, avNa: number of average alleles, Na: number of total alleles, Npa: number of polymorphic alleles, P: polymorphism, Havp: mean heterozygosity, PIC: polymorphism information content, MI: marker index and D: discriminating power |
The mean heterozygosity value (Havp) was determined the highest in the CsCAT1 primer (0.464) and the least in the CsCAT6 primer (0.351) (avg. 0.395 for all cultivars) (Table 1). In Janfaza et al. [25], the observed heterozygosity (Ho) value was determined as 0.563 on average, while the expected heterozygosity (He) value was determined as 0.512. In Martin et al. [19], Ho was obtained with the CsCAT3 marker with the highest value of 0.906. According to Mattioni et al. [17], Ho obtained with the help of different SSR markers (not used in this study) were determined as 0.52, 0.64 and 0.57 in chestnuts taken from the eastern (5 genotypes), western (5 genotypes) and central (5 genotypes) parts of Turkey, respectively. In another study, Ho values were determined as 0.78 and 0.73 [22].
The highest polymorphism information content (PIC) values were detected in the CsCAT6 (0.366) and CsCAT16 (0.366) primers, while the lowest PIC value was detected in the CsCAT1 primer with a value of 0.339 (avg. 0.357 for all cultivars) (Table 1). In a study, genetic relationship analysis in Chinese chestnuts (Castanea mollissima Blume) [28] were performed using 18 fluorescently labeled SSR markers produced from 146 chestnut genotypes, and the mean PIC value per locus was determined as 0.622. In our study, marker index (MI) was determined between 0.351 (CsCAT6)-0.464 (CsCAT1) values (avg.0.395) (Table 1). Also, discriminating power (D) were recorded between 0.370 (CsCAT16)-0.435 (CsCAT3) values (avg. 0.393) (Table 1).
According to the dendrogram obtained as a result of the analysis of the data of the drought related genomic SSR markers used in the study (Fig. 1), a group of closely related (similar) chestnut cultivars. In the dendogram, Erfelek and Hacıömer chestnut cultivars were determined as the most similar cultivars with a similarity coefficient value of 0.873. Chestnut cultivars showing close similarity with these two cultivars were determined as Siyah Bursa, Şekerci and Marigoule, while the chestnut cultivars named Osmanoğlu and Bouche de Betizac, which have a similarity coefficient of 0.810 with these cultivars, were determined to be closely related and all these cultivars emerged as a subgroup. In the other subgroup, Tülü and Kemer chestnut varieties were included with a similarity coefficient of 0.790. When these two subgroups were evaluated as a group, Işıklar and Sarıaşlama cultivars were found to be more distantly related to the cultivars in this group according to the dendogram. The principle coordinate analysis (PCoA), which was made to show the level of genetic relationship as a result of SSR analyzes, was given in Fig. 2. According to this analysis, the genetic distances among chestnut cultivars were found to support the data obtained from the dendrogram.
Genetic Relationship Evaluation of EST-SSR Analyzes
Simple sequence repeat (SSR) markers derived from expressed sequence tags (EST) are increasingly used for the assessment of genetic variation and for more effective preservation of tree-form genotypes. They are developed from expressed regions of the genome with known functions. The numerous expressed sequence tags (EST) are available for many plant species and are include EST-SSR markers [31˗34]. Although they have been reported to be less polymorphic than genomic SSRs, EST-SSR markers are expressed as superior in functional diversity with regard to adaptive variation and interspecies transferability [33˗36].
As a result of the use of 8 genic EST-SSR markers in the study, the genetic relationship level among chestnut cultivars was successfully determined and the similarities/differences could be determined. 100% polymorphism was identified for a total of 728 alleles from the use of eight primers (avg. 91 alleles per primer) (Table 2). The EST-SSR primers that gave the highest number of total allel were FIR059 (115 alleles) and VIT057 (102 alleles), while the EST-SSR primer that gave the lowest number of total allel was GOT021 (74 alleles) (Table 2). In addition, the number of average allele for each EST-SSR marker were determined as 8.27 (FIR080), 7.73 (GOT004), 6.73 (GOT021), 9.27 (VIT057), 10.45 (FIR059), 5.55 (FIR094), 7.45 (GOT045) and 6.54 (VIT033) (Table 2). However, the same EST-SSR markers were used in chestnuts by Alcaide et al. [34] and 14 (FIR059), 6 (FIR080), 4 (FIR094), 3 (GOT004), 4 (GOT021), 4 (GOT045), 2 (VIT033) and 2 (VIT057) alleles were detected. These researchers identified two specific alleles with marker FIR059 and one specific allele with marker GOT021 associated with drought tolerance. In the same study, the highest number of effective allele (Ne) was obtained from FIR059 (6.59) and GOT021 (2.33) markers.
Table 2
Some parametres obtained with genic EST-SSR markers for eleven chestnut cultivars
EST-SSR loci | Locus Motif | Forward / Reverse primer sequences (5’→3’) | Ta (oC) | SR (bp) | avNa | Na | Npa | P (%) | Havp | PIC | MI | D |
FIR059 | GA | F: GGTGGTTTCCGTGAGCATAG | 57.2 | 23–976 | 10.45 | 115 | 115 | 100 | 0.377 | 0.240 | 0.377 | 0.304 |
| R: TTGCCACACCTTCTCGTTAG |
FIR080 | ACC | F: ACCATACCTGGCTTCGATGA | 52.6 | 21–975 | 8.27 | 91 | 91 | 100 | 0.240 | 0.281 | 0.240 | 0.980 |
| R: AAGGTGAGTTGGTGGTGGAG |
FIR094 | CT | F: CAAAAGCCTCTCACTCTTGAGC | 60.0 | 19–975 | 5.55 | 94 | 94 | 100 | 0.248 | 0.278 | 0.248 | 0.979 |
| R: TCAAACCCAAACAAAACGAA |
GOT004 | TG | F: GGGCATATTGATCGCTTAGG | 60.0 | 17–976 | 7.73 | 85 | 85 | 100 | 0.343 | 0.250 | 0.343 | 0.952 |
| R: TGAGCATTCATACATTCCATGAT |
GOT021 | AT | F: AGAAAGTTCCAGGGAAAGCA | 57.2 | 19–972 | 6.73 | 74 | 74 | 100 | 0.326 | 0.256 | 0.326 | 0.958 |
| R: CTTCGTCCCCAGTTGAATGT |
GOT045 | CT complex | F: TCAACAAAACCCATTAAACCAA | 54.0 | 19–973 | 7.45 | 82 | 82 | 100 | 0.331 | 0.254 | 0.331 | 0.956 |
| R: GGATCGGAGTGAAATGGAGA |
VIT057 | AACTCG | F: TCAGCAAAATCCCAACTTTGT | 54.0 | 20–976 | 9.27 | 102 | 102 | 100 | 0.343 | 0.250 | 0.343 | 0.951 |
| R: ACACTTCGCTGTTCCTCGAT |
VIT033 | (CTT)(CCT)CTT | F: CATGAAGAACACACACGATGC | 54.0 | 17–976 | 6.54 | 86 | 86 | 100 | 0.301 | 0.264 | 0.301 | 0.966 |
| R: TTCGGTGAACTTGAACTAGGC |
| | Average | 7.75 | 91 | 91 | 100 | 0.309 | 0.262 | 0.309 | 0.287 |
| | Total | 61.99 | 728 | 728 | | | | | |
Ta: annealing temperature (oC), SR: size range, avNa: number of average alleles, Na: number of total alleles, Npa: number of polymorphic alleles, P: polymorphism, Havp: mean heterozygosity, PIC: polymorphism information content, MI: marker index and D: discriminating power |
In our study, mean heterozygosity (Havp) was determined between 0.240 (FIR080)-0.377 (FIR059) (avg. 0.309 for all cultivars) (Table 2). However, the values of the highest observed heterozygosity (Ho) determined by Alcaide et al. [34] were obtained as 0.699 and 0.691 from FIR059 and GOT021 markers, respectively. On the other hand, in our study, PIC, MI and D values were determined between 0.240 (FIR059)-0.281(FIR080), 0.240 (FIR080)-0.464 (FIR059) and 0.304 (GOT021)-0.980 (FIR059), respectively (Table 2).
According to the dendrogram obtained with drought related genetic EST-SSR markers (Fig. 3), Erfelek and Hacıömer chestnut cultivars were determined as the most similar cultivars (0.789 similarity coefficient). Together with the Marigoule chestnut cultivar, which is closely related to these two cultivars, they all formed a subgroup. Bouche de Betizac, Tülü and Sarıaşlama cultivars were closely related to this subgroup and formed another subgroup. However, the chestnut cultivars of Siyah Bursa, Osmanoğlu, Şekerci, Işıklar and Kemer were found to be more distantly related to these groups. The result of the principle coordinate analysis (PCoA) obtained with EST-SSR markers to show the genetic variation among chestnut varieties was given in Fig. 4. According to this PCoA, the genetic relationship among chestnut cultivars was found to be supportive of the results obtained from the dendrogram.
Tolerance Evaluation of Chestnut Cultivars Based on Drought-Related EST-SSR Results
It is stated that it is not easy to assess drought tolerance. Because, the drought is genetically polygenic, and is associated with a complex expression pattern of dehydration-inducible genes [37]. It is also stated that drought tolerance includes mechanisms operating at different spatial and temporal scales [38].
It is estimated that climate change will cause longer summer drought periods and increase the frequency and severity of drought events in Mediterranean type ecosystems where Turkey is located. In a study by Alcaide et al. [34] were used eight drought-related EST-SSR markers developed from oak species (Quercus spp.) [39] to investigate the adaptation potential for drought tolerance of four wild populations of C. sativa. Among the markers used, they found that the FIR059 marker showed three specific alleles (143, 160, 179 bp) for drought tolerant individuals and two specific alleles (152, 176 bp) for drought susceptible individuals (Table 3). They stated that these markers can be used as a candidate marker to predict drought tolerance in chestnut species. These researchers were determined that the FIR059 marker can be used in marker assisted selection stages to predict drought tolerance in Castanea sativa trees. On the other hand, these researchers identified one specific allele for drought tolerant individuals (94 bp) and one spesific allele for drought susceptible individuals (97 bp) with the GOT021 marker obtained with the ABI-PRISM-3130XL genetic analyzer. In addition, they identified a specific allele (193 bp) for drought tolerant individuals with FIR094 and a specific allele (152 bp) for drought susceptible individuals with FIR080 marker (Table 3). Castellana et al. [40] carried out a genetic diversity study using microsatellite (SSR) markers based on the knowledge that climatic changes in chestnut growing areas in Europe cause sensitivity in chestnuts [41] and on the knowledge of adaptability in natural habitats for this species. In their study, 5 genomic SSRs and 8 functional/genic EST-SSR markers were used. A total of 268 genotypes belonging to 10 European chestnut populations from regions with different climatic characteristics were used. A total of 202 associations were identified among 22 different alleles, 9% of which were associated with the FIR059 locus. The results underline the close relationship between climate and genetic variability and show how this approach can provide valuable information for forest species management in a rapidly changing environment. On the other hand, EST-SSRs related to drought stress have been reported in oak (Quercus spp.) [39, 42, 43], chestnut (Castanea spp.) [19] and walnut (Juglans spp.) [44]. Furthermore, drought-associated SSR markers [13, 23] were successfully used for chestnut genotypes.
Table 3
Specific alleles associated with drought tolerance identified in this study and identified in previous studies (bp) for chestnut cultivars
EST-SSR markers | Specific alleles identified by Castellana et al. (2021) | Specific alleles identified by Alcaide et al. (2019) | Data of our study |
drought tolerance | drought susceptibility | Specific alleles from this study | Cultivars |
FIR094 | 185, 193, 197 | 193 | - | 48, 62 | Erfelek, Hacıömer, Marigoule, Sarıaşlama, Bouche de Betizac, Işıklar |
GOT045 | 137, 143 | - | - | 26, 30, 52, 66, 74 26, 30 | Erfelek, Hacıömer, Marigoule, Sarıaşlama Şekerci |
GOT021 | 99, 113 | 94 | 97 | 89, 110 90, 112 | Erfelek Işıklar |
VIT033 | 79, 81 | - | - | 51, 58 57 52 | Hacıömer, Marigoule Bouche de Betizac, Işıklar, Tülü, Kemer Siyah Bursa, Şekerci |
GOT004 | - | - | - | 52, 64, 82 51, 63, 83 51, 63 | Marigoule, Osmanoğlu, Tülü Sarıaşlama, Bouche de Betizac Işıklar, Kemer |
FIR059 | 181 | 152, 176 | 143, 160, 179 | specific allele could not be identified |
FIR080 | 144, 148 | - | 152 | specific allele could not be identified |
VIT057 | - | - | - | specific allele could not be identified |
In our study, capillary electrophoresis (Qiagen-QIAxcel Advanced) system was used. The different sizes of alleles were detected than the allele sizes determined in previous research results, which were also studied in chestnuts. The reasons for this can be very different. For example, Mattioni et al. [17] commented that "a genetic difference has emerged between eastern (Greek and Turkish) and western (Italian and Spanish) chestnut populations". The differences in the levels of genetic diversity observed in regional/geographic specificity in chestnuts can be shown as a reason why specific alleles, which are among the drought-related tolerance results in the study of these researchers, were not detected in our study.
According to the peak values and images obtained using genetic EST-SSR markers, some relationships can be mentioned for drought tolerance among the preferred chestnut cultivars in our study. For example, in the marker GOT045, chestnut cultivars named Erfelek, Hacıömer, Marigoule, Sarıaşlama (26, 30, 52, 66 bp) and Şekerci (26, 30 bp) were found to have certain common alleles and therefore they are closely related (Tablo 3, Fig. 5). Serdar et al. [7] reported that "Marigoule chestnut cultivar is the most preferred cultivar in the Marmara Region as it is more drought tolerant". Based on this information, Hacıömer, Sarıaşlama and Şekerci cultivars, such as Marigoule cultivar, are likely to be drought tolerant chestnut cultivars. On the other hand, if we make an evaluation according to the 48 and 62 bp alleles determined by the FIR094 marker in our study, the chestnut cultivars named Erfelek, Hacıömer, Marigoule, Sarıaşlama, Bouche de Betizac and Işıklar were found to be closely related (Tablo 3, Fig. 5). According to the result of VIT033 marker, which is shown as a strong drought marker [40, 45], chestnut cultivars named Siyah Bursa and Şekerci (52 bp), chestnut cultivars named Bouche de Betizac, Tülü, Kemer and Işıklar (57 bp), and also the cultivars named Hacıömer and Marigoule (51, 58 bp) were observed to be closely related to each other (Tablo 3, Fig. 5).
For example, in Castellana et al. [40], the expected specific allele size for the GOT021 marker was expressed as 113 bp, and in our study, 112 bp allele was obtained in Işıklar cultivar with the GOT021 marker. In addition, for the GOT021 marker, the 94 bp allele was reported to be associated with drought tolerance in Alcaide et al. [34], and the 90 bp allele observed in Işıklar cultivar in the electrophoresis image obtained with the GOT021 marker in our study may be associated with drought tolerance. Again, the 89 bp and 110 bp alleles observed in the Erfelek cultivar in the electrophoresis image obtained with the GOT021 marker may be associated with drought tolerance (Table 3). Furthermore, 52, 64 and 82 bp alleles observed with the marker GOT004 were determined in chestnut cultivars named Osmanoğlu, Marigule, Sarıaşlama, Bouche de Betizac Tülü, Kemer, Işıklar (Tablo 3). On the other hand, although images were obtained from FIR059 (Tablo 3, Fig. 5), FIR080 and VIT057 (Table 3) markers in our study, these markers were not specific enough to comment on the relationship with drought. All these specific allele results detected with the genetic EST-SSR markers showed that these markers can be used in breeding plans related to drought tolerance in chestnuts. Moreover, these results coincide with the results of the dendogram and the PCoA analysis determined for the detection of genetic association in our study. In our study, comments were made on the information that only Marigoule chestnut cultivar is drought tolerant. After this study, which was carried out as a preliminary study, there is a need for comprehensive evaluations in which climatic data will be included in the evaluation; i) the results of this study, ii) chestnut genotypes from the natural environment of our country, iii) chestnut varieties and cultivars from chestnut collection orchards in our country's Agricultural Research Institutes.
Microsatellite based SSR and EST-SSR markers used in our study are specific markers developed from drought related genes. The use of these markers has obtained successful results specific to drought tolerance in determining the genetic relationship among chestnut cultivars of great importance in Turkey. These markers can be used in chestnut breeding studies in Turkey. Our results can be used both in more comprehensive breeding programs to determine the genetic relationships among chestnut varieties and genotypes, and in the selection of rootstock and scion.